ID: 1194264062

View in Genome Browser
Species Human (GRCh38)
Location X:91733929-91733951
Sequence GACTCTGTAGCCGCTTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194264062_1194264071 29 Left 1194264062 X:91733929-91733951 CCTGCCCAAGCGGCTACAGAGTC No data
Right 1194264071 X:91733981-91734003 ACTGGTGGCATGCGCTCATGAGG No data
1194264062_1194264072 30 Left 1194264062 X:91733929-91733951 CCTGCCCAAGCGGCTACAGAGTC No data
Right 1194264072 X:91733982-91734004 CTGGTGGCATGCGCTCATGAGGG No data
1194264062_1194264066 5 Left 1194264062 X:91733929-91733951 CCTGCCCAAGCGGCTACAGAGTC No data
Right 1194264066 X:91733957-91733979 AGCTCTGTGCTTCAGACCCAAGG No data
1194264062_1194264068 14 Left 1194264062 X:91733929-91733951 CCTGCCCAAGCGGCTACAGAGTC No data
Right 1194264068 X:91733966-91733988 CTTCAGACCCAAGGCACTGGTGG No data
1194264062_1194264067 11 Left 1194264062 X:91733929-91733951 CCTGCCCAAGCGGCTACAGAGTC No data
Right 1194264067 X:91733963-91733985 GTGCTTCAGACCCAAGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194264062 Original CRISPR GACTCTGTAGCCGCTTGGGC AGG (reversed) Intergenic
No off target data available for this crispr