ID: 1194280289

View in Genome Browser
Species Human (GRCh38)
Location X:91943612-91943634
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 2, 1: 0, 2: 1, 3: 22, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194280289 Original CRISPR CGTTAGCTGTAGGTTTTACA TGG (reversed) Intronic
905711897 1:40112012-40112034 TGTTAGCTGTGGGTTTGTCATGG - Intergenic
906444075 1:45878419-45878441 TGTTAGTTATAGGTTTTTCATGG - Intronic
907542353 1:55227556-55227578 TGTTAGCTGTGGGTTTTTCATGG + Intergenic
907817207 1:57930977-57930999 TGTTAGTTGTAGGTTTTTCATGG + Intronic
909860434 1:80598039-80598061 TGTTGGATGTAGGTTTTTCATGG - Intergenic
910899046 1:92099978-92100000 TGTCAGCTGTGGGTTTTTCATGG + Intronic
916805516 1:168256457-168256479 TGTTAGCTATAGGTTTTTAATGG + Intergenic
917776446 1:178341075-178341097 CGTCAGCTGTAAGATTTACCTGG + Intronic
918699007 1:187583301-187583323 TGTTGGCTGTAGGCTTTACCAGG - Intergenic
919625872 1:199909835-199909857 TGTTAGCTGTAAGATTTGCAAGG + Intergenic
920926970 1:210350873-210350895 CATTAGCTGTGGGTTTTTTATGG + Intronic
921116354 1:212095215-212095237 CGTTGGCTGTGGGTTTGTCATGG + Intronic
1063773329 10:9229761-9229783 TGAAAGCTGTAGGTTTTTCAGGG + Intergenic
1064892924 10:20198985-20199007 GGTTAGCTGTAGATTATTCATGG + Intronic
1065147499 10:22784706-22784728 CATTAGCTGTAGGTTTTTGGTGG + Intergenic
1065498353 10:26353131-26353153 ATATAGCTGTATGTTTTACAAGG + Intergenic
1065782324 10:29181575-29181597 CATTAGCTGAAGGGTTTATAGGG + Intergenic
1065825247 10:29564625-29564647 CTTTCCCTGTAGTTTTTACAGGG - Intronic
1067050784 10:43018810-43018832 TGTTAGCTTTGGGTTTTTCACGG - Intergenic
1069574063 10:69514022-69514044 TGTTAGATGTAGGTTTTTCATGG + Intergenic
1070635413 10:78122648-78122670 TGTTAGCTGTGGGTTTTTCATGG - Intergenic
1070822251 10:79365965-79365987 TGTTAGCTCTAGGTTTGTCATGG - Intergenic
1071282406 10:84114510-84114532 CATCAGCTGCAGGTTTCACATGG - Intergenic
1075019040 10:118934941-118934963 TGTTAGCTGTAGGTTTTTGTAGG - Intergenic
1083051715 11:59783048-59783070 TATTAGCTGTAAATTTTACATGG + Intronic
1084783566 11:71428292-71428314 AGTTAGCTGTAGGTTTTCTATGG + Intronic
1090166004 11:124548316-124548338 TTTTAGCTGTAGGTTTTTCACGG - Intergenic
1094432170 12:30381082-30381104 TGTTAGCTGTAGGTTTTCATAGG - Intergenic
1098688407 12:73455334-73455356 CGAGAGCTGATGGTTTTACAAGG + Intergenic
1099208175 12:79752405-79752427 CTTTATCAATAGGTTTTACATGG + Intergenic
1100120749 12:91366769-91366791 CATTAGCTGTGGGTTGTAGAAGG - Intergenic
1105533285 13:21240209-21240231 TTTCAGCTGTAGGTTTGACAAGG - Intergenic
1112084888 13:96019844-96019866 CTTCAGCTTTTGGTTTTACAAGG + Intronic
1116282255 14:42924387-42924409 TGTTGGCTGTAGGTTTGTCATGG + Intergenic
1119096506 14:71837522-71837544 TGTAAGCTGTAGGTTTTTCTAGG + Intergenic
1124418964 15:29501534-29501556 TGTTAGCTATTGGTTTTTCATGG - Intronic
1126159858 15:45600425-45600447 TGTTAGCTGCAGGTTTTTCAAGG + Intronic
1127009476 15:54606832-54606854 CGTTAGCCATAGGAATTACATGG + Intronic
1127162066 15:56199068-56199090 TCTTAGCTGTAGGTCCTACATGG - Intronic
1127345977 15:58098835-58098857 TGTTAGCTGTGGGTTTTTCAGGG + Intronic
1128323626 15:66708985-66709007 AGGTAGCTGCAGGTGTTACAGGG - Intronic
1129480060 15:75816676-75816698 TGTCAGCTGTTGGTTTAACAAGG - Intergenic
1136640362 16:31559046-31559068 TGTTGGCTGTGGGTTTTTCATGG - Intergenic
1136664527 16:31797611-31797633 TGTTGGCTGTGGGTTTTTCATGG + Intergenic
1146781559 17:35678494-35678516 CGTTAGCCATAGGTTTTTCGTGG + Intronic
1149022475 17:51985379-51985401 TGTTAGCTGTGGGTTTGTCATGG - Intronic
1149128722 17:53268840-53268862 CGTTGACTGTGGGTTTTTCATGG + Intergenic
1149587130 17:57798651-57798673 TGTTAGCTGTAGGTTTTCTTAGG + Intergenic
1152159978 17:78662017-78662039 CCCCAGCTGTAGGTTTTTCAGGG - Intergenic
1152777103 17:82208960-82208982 CTTGAGCTGTAGCTTTTAGATGG - Intronic
1153317133 18:3735051-3735073 ACTTAGATGTAGTTTTTACATGG + Intronic
1153767646 18:8389437-8389459 TGATTGCTTTAGGTTTTACATGG - Intronic
1168057406 19:53870825-53870847 TGGAAGCTGTAGGTTTTGCAAGG + Intronic
926532668 2:14069940-14069962 CGTTATATGTAGTTTTTCCACGG - Intergenic
929018056 2:37521239-37521261 TGTTAGCTGTAGGTTTTGCATGG + Intergenic
933155166 2:78965133-78965155 TGTTATCTTTAGTTTTTACAGGG + Intergenic
934918087 2:98317252-98317274 CGTTTGCTGTTGTTTTTACTTGG - Intergenic
935079567 2:99779151-99779173 TGTTAGCTGTGGGTTTTCCATGG + Intronic
935613558 2:105052241-105052263 TGTTAGCTGTGCGTTTTTCATGG + Intronic
936231728 2:110707776-110707798 TGTTAGCTGTGGGTTTTTCATGG + Intergenic
937739324 2:125332140-125332162 TGTTAGCTCTAAGTTTTTCACGG - Intergenic
940399101 2:153226347-153226369 CTTTAAATGTAGGTTATACATGG + Intergenic
940535474 2:154935717-154935739 CCTCTTCTGTAGGTTTTACATGG + Intergenic
943522957 2:188976506-188976528 TGTTCCCTGTGGGTTTTACAAGG + Intronic
943694511 2:190910167-190910189 CGTTAGCTGTGCTTTTTCCAAGG + Intronic
944730616 2:202513311-202513333 AGTTAGCTGTAAGATTTAGATGG - Intronic
947240613 2:227990198-227990220 TCTTTGCTTTAGGTTTTACAAGG - Intronic
1168730380 20:73210-73232 TGTTAGCTCTAGGTATTATAAGG - Intergenic
1170348887 20:15418200-15418222 CGGAAGCTGTAGAATTTACAAGG + Intronic
1176524970 21:7859181-7859203 TGTTATCTTTAGTTTTTACAGGG + Intergenic
1178568320 21:33709994-33710016 TGTTAGATGTAGGTTGTTCATGG + Intronic
1178658990 21:34489194-34489216 TGTTATCTTTAGTTTTTACAGGG + Intergenic
1180104779 21:45610992-45611014 CGTTAACTGAGGGTTTTCCATGG + Intergenic
1185326616 22:50228741-50228763 GGTGAGGTGTAGGTTTTAGATGG - Intronic
949528302 3:4928185-4928207 TGTTAGCTTAATGTTTTACATGG - Intergenic
951165847 3:19484582-19484604 CAGTGGCTGTAGGTTTCACATGG + Intronic
953995735 3:47518281-47518303 TGTTAGCTGTGGGTTTTTCATGG + Intergenic
957001254 3:74887696-74887718 TGTTAGGTATAGGTTTTTCATGG + Intergenic
959116467 3:102184290-102184312 CACTAGGTGCAGGTTTTACATGG + Intronic
959508944 3:107188234-107188256 TGTTAGCTGTAGGTTTTTTGTGG - Intergenic
960683815 3:120276786-120276808 TGTTAGCTGTAGGTTTATCAGGG + Intronic
961669013 3:128514467-128514489 TGTTAACTGTAGGTTCTTCATGG + Intergenic
962297167 3:134201162-134201184 AGTTAGGTTTAGATTTTACAGGG - Intronic
962485445 3:135838226-135838248 TGTTTTCTGTAGGTTTTACAAGG + Intergenic
963297090 3:143558103-143558125 CTTTAGCTCCAGCTTTTACATGG + Intronic
968779295 4:2567692-2567714 CGTTACCAGTAGGAGTTACAGGG + Intronic
973652306 4:53008233-53008255 CATCAGCTGTAGGTTTTAAGAGG - Intronic
978250426 4:106624933-106624955 TGTTAGCTGAAGGATTTTCATGG + Intergenic
979158911 4:117433175-117433197 TGTTAGCTGTAGGTTTTGTGTGG + Intergenic
985317531 4:188673652-188673674 TGTTAGCAGTAGGCTTTAGAAGG + Intergenic
985431684 4:189887528-189887550 CAATACCTGAAGGTTTTACAAGG - Intergenic
992241832 5:74778903-74778925 AGTTATCTGTAGTTTTTGCAAGG - Exonic
992386191 5:76286826-76286848 CGGTATCTGATGGTTTTACAAGG - Intronic
992533622 5:77675633-77675655 TGTTAGCTATAGGTTTGTCATGG - Intergenic
993714607 5:91263258-91263280 TGTTAGCTCTAGGTTTTCCACGG - Intergenic
1000602759 5:163295108-163295130 CATTAGCTGTGTGTTTGACAAGG - Intergenic
1001481021 5:172089311-172089333 CATTAGGTGTAAGTTCTACAAGG + Intronic
1009268220 6:61584335-61584357 CATTAGCTCTAAGTTTTTCATGG + Intergenic
1009539603 6:64936315-64936337 TGTTAGCTGTAGATTTTTCATGG - Intronic
1014358392 6:120442109-120442131 TGATAGCTGTAGGTTTTTGAAGG - Intergenic
1014408023 6:121075730-121075752 TGTTAGCTGTAGGTTTCCCAGGG - Intergenic
1014604224 6:123452116-123452138 TGTTGGCTGTGGGTTTTTCATGG - Intronic
1014939807 6:127424740-127424762 AGTTTACTGTAGGTTTTTCATGG - Intergenic
1016421567 6:143890464-143890486 TGTTAGCTGTAGATTTCTCAAGG - Intronic
1017328729 6:153171126-153171148 TGATAGCTGTAGGTTTTAGCTGG + Intergenic
1018781801 6:167075083-167075105 TGTTAGCTGTAGGTTTTTTGTGG - Intergenic
1019806876 7:3134034-3134056 CGTTAGCTGTGGGTTTTCTGTGG + Intergenic
1020425880 7:8065524-8065546 CGTTGGCTGTGGGTTTTTCTTGG + Intronic
1020504865 7:8972745-8972767 CGTTAGCTGTAAGCTTGTCATGG + Intergenic
1020514645 7:9102323-9102345 TGTTAGCTGTAGGATTTTCATGG + Intergenic
1020706810 7:11554433-11554455 TGTTAGCTATAGGTTTTCCTAGG + Intronic
1021779587 7:24089814-24089836 TGTTGGCTGTAGGTTTGTCATGG + Intergenic
1023213629 7:37835081-37835103 TGTTAGCTGTAAGTTTCAGACGG + Intronic
1024438395 7:49386654-49386676 TGTTAGCTGTAGGTTTTTGTAGG + Intergenic
1027415647 7:77971472-77971494 CATTAGCTGTAAGTTTTTTATGG + Intergenic
1028620210 7:92817517-92817539 TGTTAGCTGTAAGTTTTCCTAGG - Intronic
1028868838 7:95743373-95743395 CGTGATCTGATGGTTTTACAAGG + Intergenic
1030004213 7:105099474-105099496 AATTAGCTGTAGTGTTTACAGGG + Intronic
1030961166 7:115925022-115925044 TGTTTGCTGTAGGTCTTTCATGG - Intergenic
1039934269 8:42026887-42026909 CGTTAGCTGTGGGTTTGTCATGG + Intronic
1040611464 8:48987484-48987506 TGTTAGCTGTAGGTTTTTGTAGG + Intergenic
1040695304 8:49989970-49989992 TGTTAGCTATAGGTTTTTCATGG - Intronic
1042703878 8:71646297-71646319 TGTTGGCTGTAGGTTTGTCAAGG + Intergenic
1042774691 8:72417426-72417448 TGTTAGCTGTTGGTTTTTCATGG + Intergenic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1185828983 X:3280611-3280633 CCTGAGCTGTAGTTTTTAAAGGG + Intronic
1186216658 X:7307898-7307920 TGTTATCTGTAGTTATTACAGGG + Intronic
1189671225 X:43411449-43411471 TGTTAGCTGTAGGTTTTTATAGG + Intergenic
1192805946 X:74509312-74509334 TGTTAGCTATAGGCTTTTCATGG + Intronic
1193646552 X:84076664-84076686 TGTTAGCTGTGGGTTTTATATGG - Intronic
1194280289 X:91943612-91943634 CGTTAGCTGTAGGTTTTACATGG - Intronic
1195839985 X:109164505-109164527 TGTTAGCTGTGGGTTTTTCATGG + Intergenic
1197857839 X:130935799-130935821 TGTTAGCTGTTGGTTTTTCTAGG - Intergenic
1200334811 X:155338974-155338996 GGTTCACTGTAGGTTTTCCATGG + Intergenic
1200351655 X:155502247-155502269 GGTTCACTGTAGGTTTTCCATGG - Intronic
1200597766 Y:5167106-5167128 CGTTAGCTGTAGGTTTTACATGG - Intronic
1201297227 Y:12474308-12474330 CATTGGCTGCAGGTTTCACACGG + Intergenic