ID: 1194283677

View in Genome Browser
Species Human (GRCh38)
Location X:91983638-91983660
Sequence ACTGTTCTCCTGACAGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 937
Summary {0: 1, 1: 5, 2: 60, 3: 309, 4: 562}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194283677 Original CRISPR ACTGTTCTCCTGACAGTGAA TGG (reversed) Intronic
901464383 1:9411956-9411978 ACTGTTCTCGTGACGGTGAATGG + Intergenic
901750926 1:11407828-11407850 GCTGTTCTGGTGATAGTGAATGG + Intergenic
902611518 1:17600340-17600362 GCTGTTCTCTTGACAGTCTAAGG + Intronic
903101106 1:21030341-21030363 GCTGTTCTCTTGATAGTGAATGG + Intronic
903443867 1:23408315-23408337 ACTGGTCCCCTGACAGTGATGGG + Intronic
903707448 1:25296672-25296694 GCTGTTCTTGTGACAGTGAGTGG + Intronic
903719791 1:25396682-25396704 GCTGTTCTTGTGACAGTGAGTGG - Intronic
904057587 1:27682030-27682052 GCTGGTCTCATGATAGTGAATGG - Intergenic
905492549 1:38355756-38355778 GCTGTTCTCAGGATAGTGAATGG + Intergenic
905496019 1:38387162-38387184 GCTGTTCTCATGATAGTGAATGG - Intergenic
906187916 1:43875574-43875596 GCTGTTCTCATGATAGTGAATGG + Intronic
906763852 1:48408816-48408838 GCTGTTCTCATGATAGTGAATGG - Intronic
907347146 1:53791712-53791734 CCTGTTTTCTTGAAAGTGAAAGG - Intronic
908004212 1:59711748-59711770 GCTCTTCTCATGATAGTGAATGG - Intronic
908068466 1:60433389-60433411 GCTGTTCTCATGATAATGAATGG - Intergenic
908068746 1:60435318-60435340 GCTGTTCTCATGATAGTGAATGG - Intergenic
908387787 1:63659000-63659022 GCTGTTCTCATGATAGTGAATGG - Intronic
908640167 1:66213906-66213928 ACTCTTCTCCTGAAAGTGATGGG - Intronic
908667819 1:66511490-66511512 GCTTTTCTCCTGATAGTGAATGG + Intergenic
908989480 1:70069356-70069378 GCTGTTCTCATGATAGTGAGTGG - Intronic
909054356 1:70804691-70804713 GCTGTTCTTGTGATAGTGAATGG + Intergenic
909095079 1:71276315-71276337 GCTGTTCTTCTGAAAGTGAGTGG + Intergenic
909105317 1:71398853-71398875 GCTGTTCTTGTGATAGTGAATGG + Exonic
909153912 1:72045488-72045510 GCTGTTCTCCTGATAGTGAATGG + Intronic
909182920 1:72448575-72448597 GTTGTTCTCGTGATAGTGAATGG - Intergenic
909185509 1:72481162-72481184 ACTGTTCTTGTGATAGTGAATGG - Intergenic
909204521 1:72738426-72738448 GCTGTTCTCTTGAGAGTGAATGG - Intergenic
909257341 1:73439991-73440013 GCTGTTCTTGTGATAGTGAATGG + Intergenic
909317101 1:74236633-74236655 TCTGGTCTCTTGACATTGAAAGG + Intronic
909416748 1:75415275-75415297 GCTGTTCTCATGATAGTGAGTGG + Intronic
909469789 1:76014093-76014115 GCTGTTCTTGTGATAGTGAATGG - Intergenic
909602792 1:77478380-77478402 GCTGTTCTCATGATAGTGAATGG + Intronic
909953849 1:81753345-81753367 GCTATTCTCATGATAGTGAATGG - Intronic
910255980 1:85248186-85248208 GCTGTTCTCATGCTAGTGAATGG - Intergenic
910309227 1:85804674-85804696 GCTGTTCTCGTGATAGTGAATGG - Intronic
910329045 1:86047946-86047968 ACTGTTGACTTGAAAGTGAATGG - Intronic
910481502 1:87663110-87663132 GCTGTTCTCATGATAGTGAGTGG + Intergenic
910512758 1:88025003-88025025 GCTGTTCTCATGATAGTGAATGG - Intergenic
910513034 1:88026943-88026965 GCTGTTCTCATGGTAGTGAATGG - Intergenic
910581853 1:88837067-88837089 ACTCTTTCCCTGACAGTGGAAGG + Intergenic
910606987 1:89097794-89097816 GCTGTTCTTGTGACAGTAAATGG + Intergenic
910835000 1:91500139-91500161 ACTGTTGTCCTGGCAAAGAAAGG - Intergenic
910987153 1:93016671-93016693 ACTGTTATCATCAGAGTGAAAGG + Intergenic
911134822 1:94428603-94428625 GCTGTTCTCGTGATAGTGAACGG + Intronic
911686399 1:100781806-100781828 GCTGTTCTCGTGATAGTGAATGG - Intergenic
911840625 1:102676705-102676727 CCTTTTCTCATGACAGTGAATGG - Intergenic
911951785 1:104182420-104182442 TCTGTTTGCATGACAGTGAATGG + Intergenic
912609335 1:111027643-111027665 GCTGTTCTCCTGATAGTGAATGG + Intergenic
913284069 1:117211167-117211189 ACTTTCCTCCTGACTGTGGAAGG + Intergenic
915767240 1:158374711-158374733 ACTGTTAACCTGACAGTGAGAGG - Intergenic
915804472 1:158829967-158829989 GCTGTTCTCATGATAGTAAATGG - Intergenic
916959076 1:169871303-169871325 CCTGTTCTCATGATAGTGAATGG + Intronic
917023589 1:170616108-170616130 GCTGTTCTCACGATAGTGAATGG + Intergenic
917177073 1:172247218-172247240 ACTACTCTCCTGGCAATGAATGG - Intronic
918028018 1:180772643-180772665 GCTCTTCTCATGATAGTGAATGG + Intronic
918079354 1:181193774-181193796 GCTGTTCTTGTGATAGTGAATGG + Intergenic
918079626 1:181195710-181195732 GCTGTTCTTGTGATAGTGAATGG + Intergenic
918727898 1:187948505-187948527 GCTGTTCTCATGATAGTGAATGG + Intergenic
919536871 1:198798111-198798133 GCTGTTCTCGTGATAGTGAGGGG - Intergenic
921758199 1:218883114-218883136 GCTGTTCTCATGATAGTGAGGGG - Intergenic
922115201 1:222606890-222606912 GCTGTTCTCATGATAGTGAATGG - Intergenic
922145564 1:222940368-222940390 GCTGTTCTCATGATAGTGAGTGG - Intronic
923259379 1:232252753-232252775 GCTGTTCTCGTGATAGTGAATGG + Intergenic
924062437 1:240188955-240188977 GCTCTTCTCATGATAGTGAATGG - Intronic
1063550761 10:7030743-7030765 GCTGTTCTCATGATAGTGAGTGG - Intergenic
1065070459 10:22018853-22018875 ACTGTTCTTCTCCCATTGAATGG - Intergenic
1065739992 10:28788583-28788605 ACTGTTTTACTGACAGTCAAAGG + Intergenic
1066636715 10:37510465-37510487 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1066636948 10:37512419-37512441 GCTGTTCTCATAATAGTGAATGG + Intergenic
1067829628 10:49603071-49603093 ACTGTACTCATCACACTGAATGG - Intergenic
1067834036 10:49627117-49627139 ACTGTTCTCCAGAAGGGGAATGG - Intronic
1067981671 10:51093485-51093507 AAAGTTCTCCTGGAAGTGAAAGG - Intronic
1068055808 10:52011843-52011865 GCTGTTCTCGTGATAGTGAATGG + Intronic
1068264145 10:54625494-54625516 GCTGTTCTCATGATGGTGAATGG + Intronic
1068264402 10:54627405-54627427 ACTGTTCTCATGATAGTGAATGG + Intronic
1068305768 10:55205979-55206001 GCTGTTCTCGTGATAGTGAATGG - Intronic
1068747619 10:60552853-60552875 GCTGTTCTTGTGATAGTGAATGG + Intronic
1069156822 10:65039741-65039763 GCTGTTCTCATGATAGTGAGTGG + Intergenic
1069549690 10:69354498-69354520 GCTGTTCTCGTGATAGTGAGTGG - Intronic
1070375840 10:75830601-75830623 ATTGTTCTCATGATAGTGAATGG - Intronic
1070376149 10:75832843-75832865 GTTGTTCTCGTGATAGTGAATGG - Intronic
1071018683 10:81027686-81027708 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1071557842 10:86619660-86619682 TCTATTCTCATGATAGTGAATGG - Intergenic
1072144334 10:92620800-92620822 GCTGTTCTCATTACAGGGAATGG - Intronic
1072307134 10:94118530-94118552 GCTGTTCTCATGATAGTGAATGG + Intronic
1072852785 10:98914158-98914180 GCTGTTCTTGTGATAGTGAATGG + Intronic
1073260295 10:102184730-102184752 GCTGTTCTGGTGATAGTGAATGG - Intergenic
1073730601 10:106283054-106283076 GCTGTTCTCATGATAGTGAATGG - Intergenic
1073833242 10:107411068-107411090 GCTGTTCTCATGATAGTGAGTGG + Intergenic
1074207917 10:111300539-111300561 GCTGTTCTCATGGTAGTGAATGG + Intergenic
1074969647 10:118525567-118525589 GCTGTTCTCATGATAGTGAGTGG + Intergenic
1075354412 10:121757679-121757701 ACTGTTTTTGTGATAGTGAATGG - Intronic
1075571107 10:123546406-123546428 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1075826020 10:125357624-125357646 ACTGTTCTCGTGATAGTGAATGG - Intergenic
1077744881 11:4891397-4891419 ACTGTCCTCTTGATAGTGAGTGG - Intronic
1077797265 11:5505703-5505725 GCTGTTCTCGTGACAGTGAATGG - Intronic
1077932677 11:6750859-6750881 GCTGTTCTAGTGAGAGTGAATGG + Intergenic
1078442997 11:11383049-11383071 CCTGATCTCCTGACATTGGAGGG + Intronic
1079272761 11:19004088-19004110 GCTGTTCTTGTTACAGTGAATGG + Intergenic
1079298326 11:19254714-19254736 GCTGTTCTCATGATAGTGAATGG - Intergenic
1079694266 11:23459510-23459532 GCTATTCTCTTGATAGTGAATGG - Intergenic
1079838373 11:25364478-25364500 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1080087519 11:28302491-28302513 GCTGTTCTCATGATAATGAATGG + Intronic
1080088380 11:28314806-28314828 GCTGTTCTCCTGATAGTGAATGG + Intronic
1080088646 11:28316741-28316763 TTTGTTCTCCTGATAGTGAGTGG + Intronic
1080796721 11:35571025-35571047 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1081019639 11:37929582-37929604 ACAATTCTCTTGACAGTGAAAGG + Intergenic
1081120741 11:39262687-39262709 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1081239041 11:40680542-40680564 GCTGTTCTCGTGATACTGAAAGG + Intronic
1081507768 11:43735929-43735951 GCTGTTCTCGTGACAGTGAGTGG - Intronic
1081635005 11:44715277-44715299 GCTGTTCTTATGACAGTGAGTGG - Intergenic
1082709550 11:56537717-56537739 ACTGTTTGCCTGACAGTTATTGG + Intergenic
1083120252 11:60505279-60505301 GCTGTTCTTGTGACAGTGAATGG - Intronic
1084880542 11:72168327-72168349 GCTGTTCTCATGATAATGAATGG + Intergenic
1085642353 11:78200395-78200417 ACTCCTCTCCTCACAGTCAAAGG - Intronic
1085941959 11:81215210-81215232 GCTATTCTCCTGATAGTGAATGG - Intergenic
1086675717 11:89604847-89604869 ATTGTTCTCCTTTCAGTTAACGG + Intergenic
1086764444 11:90676717-90676739 GCTGTTCTCATGATAGTGATTGG + Intergenic
1086844659 11:91733615-91733637 GCTGTTCTCATGATAGTGAGTGG - Intergenic
1086850218 11:91799648-91799670 ACTATTCTCGTGATAGTGAATGG - Intergenic
1087226490 11:95606599-95606621 GCTGTTCTCCTGATAGTGAATGG - Intergenic
1087255415 11:95947854-95947876 GCTATTCTCATGATAGTGAATGG - Intergenic
1087325324 11:96714741-96714763 GCTGTTCTCATGATATTGAATGG - Intergenic
1087450916 11:98323412-98323434 ACTGCTATGCTCACAGTGAAAGG - Intergenic
1087497464 11:98908904-98908926 GCTGTTCTCATGATACTGAATGG + Intergenic
1087516699 11:99173084-99173106 GCTGTTCTCATGACAGTGAGTGG - Intronic
1087838223 11:102895998-102896020 GCTGTTCTCATGATAGTGAATGG + Intergenic
1087864246 11:103204171-103204193 GCTATTCTCATGATAGTGAATGG - Intronic
1088206152 11:107395165-107395187 GCTGTTCTCGTGATAGTGAATGG + Intronic
1088524840 11:110741260-110741282 GCTGCTCTCATGATAGTGAATGG + Intergenic
1088531228 11:110811926-110811948 ACTGTTCTCATGATAGTGAATGG - Intergenic
1088668350 11:112117375-112117397 GCTGTTCTCATGATAGTGAATGG - Intronic
1089584296 11:119500431-119500453 GCTGTTCTCATGATAGTGAACGG + Intergenic
1090254248 11:125272175-125272197 ACAGTCCTCCTGGCTGTGAAGGG + Intronic
1090638796 11:128712671-128712693 GCTGTTCTCATGATAGTGAATGG - Intronic
1090864020 11:130679805-130679827 GCTGTTTTCATGAGAGTGAATGG - Intronic
1090937763 11:131360204-131360226 ACAGTTCTCTTGACATTGACAGG + Intergenic
1093193702 12:16105334-16105356 GCTGTTCTCATGATAGTGAATGG - Intergenic
1093352972 12:18127135-18127157 GCTGTTCTAGTGACAGTGAATGG + Intronic
1093974075 12:25401645-25401667 GCTGTTCTCTTAATAGTGAATGG + Intergenic
1094069039 12:26392566-26392588 ACTGTTCTCCAGACACTGCCAGG - Intronic
1094182320 12:27604975-27604997 GCTGTTCTTGTGATAGTGAATGG - Intronic
1094417080 12:30228497-30228519 GCTGTTTTCATGATAGTGAATGG + Intergenic
1094599028 12:31892261-31892283 GCTGTTCTCGTGATAGTGAGTGG + Intergenic
1094759419 12:33513397-33513419 GCTGTTCTCCTGATAGTAAATGG + Intergenic
1095324351 12:40870004-40870026 GCTGTTCTCATGATAGTGAGTGG + Intronic
1095340045 12:41079549-41079571 GCTACTCTCCTGATAGTGAATGG + Intergenic
1095731700 12:45512743-45512765 GCTGTTCTCATGATAGTGAGGGG - Intergenic
1095796327 12:46222914-46222936 GCTGTTTTCATGACAGTAAAGGG + Intronic
1095928676 12:47605033-47605055 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1097343510 12:58466356-58466378 AGTGTTCTCGTGATAGTGAGTGG - Intergenic
1097429450 12:59486537-59486559 GCTGTTCTCCTGACAGTGGTTGG + Intergenic
1097503199 12:60432262-60432284 GCTGTTCTCCTGAGGGTGAGAGG + Intergenic
1097626466 12:62007448-62007470 ACTGTTCTGTTCACAGTGACTGG + Intronic
1098201220 12:68058032-68058054 GCTGTTCTCATGATAGTGAATGG - Intergenic
1098489418 12:71058312-71058334 GCTGTTCCCATGATAGTGAATGG + Intronic
1098743296 12:74201656-74201678 GCTGTTCTTATGACAGTGAATGG - Intergenic
1098768480 12:74520813-74520835 GCTCTTCTCATGATAGTGAATGG - Intergenic
1098836917 12:75434578-75434600 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1098890708 12:76007844-76007866 GCCGTACTCCTGCCAGTGAAGGG - Intergenic
1099389155 12:82057626-82057648 ACAGTTCTCCTTACATTGAGAGG - Intergenic
1099840160 12:87954830-87954852 GCTGCTCTCATGATAGTGAATGG + Intergenic
1099891590 12:88595090-88595112 ACTGATTTCATGACAATGAAGGG + Intergenic
1099937700 12:89147530-89147552 GCTGTTCTTATGATAGTGAATGG + Intergenic
1099990864 12:89719419-89719441 ACTGTTGTTGTGATAGTGAATGG + Intergenic
1100072353 12:90736124-90736146 GCTGTTCTCATGACAGTGAGTGG - Intergenic
1100576959 12:95901009-95901031 TCTGTTCTCCATACAGTGATAGG - Intronic
1100811704 12:98345184-98345206 GCTATTCTCTTGATAGTGAAAGG - Intergenic
1101464729 12:104936625-104936647 GCTGTTCTCATGATAGTGAATGG - Intronic
1101766007 12:107700065-107700087 GCTGTTCTCATGATAGTGAATGG - Intronic
1102843537 12:116152545-116152567 TCTGGTCTTCTGACAGTGCAGGG - Intronic
1104025625 12:125024266-125024288 GCTGTTCTTGTGACAGTGGAGGG - Intronic
1104900948 12:132189272-132189294 TCTGTCATCCTGACTGTGAAGGG + Intergenic
1105609574 13:21956236-21956258 GCTGTTCTGGTGATAGTGAATGG - Intergenic
1106877424 13:34088996-34089018 GCTGTTCTCATGACAGTGAGTGG + Intergenic
1107101997 13:36603252-36603274 GCTGTTCTCGTGATAGTGAGTGG - Intergenic
1107541917 13:41396748-41396770 GCTGTTCTCATGATAATGAATGG - Intergenic
1107554622 13:41507174-41507196 GCTGTTCTCATGAGAGTGAATGG - Intergenic
1107863159 13:44680302-44680324 GCTGTTCTCATGATAGTGAATGG + Intergenic
1108103142 13:46979277-46979299 GCTGTTCTCGTGATAGTGAGTGG - Intergenic
1108142371 13:47437253-47437275 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1108719514 13:53117032-53117054 GCTGTTCTCATAATAGTGAATGG - Intergenic
1108983057 13:56544771-56544793 ACATTTCTGCTGACAGTGATAGG - Intergenic
1108993830 13:56699366-56699388 ACTGTTTTCATGATAGTGAGTGG + Intergenic
1109285598 13:60404907-60404929 GCTGTTCTCGTGATAGTGAATGG + Intronic
1109314986 13:60739889-60739911 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1109393414 13:61722903-61722925 GCTGTTCTCGTGTTAGTGAATGG + Intergenic
1109764841 13:66881439-66881461 GCTGTTCTCTTGATAATGAATGG - Intronic
1109811356 13:67517085-67517107 GCTGTTCTCGTGATAGTGAGTGG - Intergenic
1109906068 13:68844261-68844283 GCTGTTCTCATGATAGTGAATGG + Intergenic
1110377725 13:74813440-74813462 ACTGTTCTCATGATAGTGAATGG + Intergenic
1110377981 13:74815275-74815297 GCTGTTCTCATGATAGTGAATGG + Intergenic
1110649273 13:77924791-77924813 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1111029246 13:82574517-82574539 GCTGTTCTCATGATAGTGAATGG - Intergenic
1111054615 13:82932537-82932559 GCTGTTCTCCTGTTGGTGAATGG + Intergenic
1111629901 13:90837058-90837080 GGTGTTCTTATGACAGTGAATGG - Intergenic
1111686471 13:91507530-91507552 GCTGTTCTTGTGATAGTGAATGG - Intronic
1111778503 13:92692980-92693002 ACTATTCTCATGACAATGAGTGG + Intronic
1111956699 13:94766802-94766824 GCTGTTCTGGTGACAGTGAGTGG - Intergenic
1112071268 13:95853032-95853054 CCTGTTCTCTTGACAGTGAGTGG + Intronic
1112159554 13:96853470-96853492 GCTATTCTCATGATAGTGAATGG + Intergenic
1112320037 13:98397414-98397436 ACTGTTCACCAGAGTGTGAATGG - Intronic
1113285079 13:108837152-108837174 GCTGTTCTCATGATAGTGAGTGG + Intronic
1114320831 14:21546000-21546022 GCTGTTCTCTTGATAGTGAATGG - Intergenic
1114589104 14:23843310-23843332 GCTGTTTTCCTGGCAGTGAAGGG + Intergenic
1114593875 14:23894474-23894496 GCTGTTTTCCTGGCAGTGATGGG - Intergenic
1114764886 14:25359599-25359621 ACTGTTCTCCTCACAATGATTGG - Intergenic
1114984407 14:28209283-28209305 GCTGTTCTCATGATAGTGAATGG + Intergenic
1115002437 14:28439207-28439229 GCTGTTCTCGTGACAGTGAATGG + Intergenic
1115773391 14:36689242-36689264 GCTGTTCTCGTGATAGTGAATGG - Intronic
1115840163 14:37461368-37461390 GCTGTTCTTATGATAGTGAATGG - Intronic
1115968348 14:38916929-38916951 ACTGTTCTCATGATAGTGATGGG - Intergenic
1116085523 14:40232424-40232446 ACTGATCTCATCACACTGAATGG - Intergenic
1116368586 14:44101925-44101947 CATGTCCTCCTGAGAGTGAATGG - Intergenic
1116428623 14:44820531-44820553 ACTTTTCTCCTGCCAGTGCCAGG + Intergenic
1116618045 14:47163440-47163462 GCTGTTCTGGTGATAGTGAATGG + Intronic
1116642603 14:47484737-47484759 GCTGTTCTCCTAATAGTGAATGG + Intronic
1116761964 14:49026009-49026031 GCTGTTCTCATGATAGTGAATGG + Intergenic
1116762229 14:49027939-49027961 GCTGTTCTCATGATAGTGAATGG + Intergenic
1117004233 14:51402413-51402435 GCTGTTCTCATGATAGTGAGTGG + Intergenic
1117020410 14:51564726-51564748 GCAGTTCTCCTAACAGTTAAAGG + Intronic
1117221076 14:53606965-53606987 AAGATTCTTCTGACAGTGAAAGG + Intergenic
1117313156 14:54548453-54548475 ACTTTTCTCCTGACAGTAAATGG - Intergenic
1117905970 14:60587270-60587292 ACTTTTCTCATCACAGTGAGAGG - Intergenic
1117977604 14:61313791-61313813 GCTGTTCTCATGACAGTGAGTGG - Intronic
1118069482 14:62230774-62230796 GCTGTTCTCATGATAGTGAATGG + Intergenic
1118071030 14:62246600-62246622 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1118138905 14:63058009-63058031 ACATTTCTCTTGACTGTGAATGG - Intronic
1118485692 14:66212734-66212756 ATAGTTCTGTTGACAGTGAAAGG - Intergenic
1118597837 14:67449754-67449776 GCTGTTCTTGTGATAGTGAATGG + Intronic
1118598149 14:67451988-67452010 GCTGTTCTCATGATAGAGAATGG + Intronic
1118863816 14:69686723-69686745 GCTGTTCTCATGATAGTGAATGG - Intronic
1119200422 14:72747765-72747787 GCTGTTCTTATGATAGTGAATGG + Intronic
1119369825 14:74130060-74130082 ACTGTTCTCCTGATAGCAAGTGG - Intronic
1119891404 14:78185267-78185289 AATGACCTCCTGCCAGTGAAGGG + Intergenic
1120150304 14:81025127-81025149 ACATTTCTCTTGACTGTGAATGG + Intronic
1120248055 14:82028830-82028852 GCTGTTCTCATGATAGTGAATGG - Intergenic
1120606243 14:86582282-86582304 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1120622077 14:86776242-86776264 GCTGCTCTCATGATAGTGAATGG + Intergenic
1120712620 14:87808360-87808382 GCTGTTCTCATGAAAGTGAATGG + Intergenic
1120742022 14:88118877-88118899 GCTGATCTCGTGATAGTGAATGG - Intergenic
1120918196 14:89729236-89729258 ACGGCTCTCCTGGCAGTGACAGG + Intergenic
1121203025 14:92135963-92135985 GCTGTTCTTGTGATAGTGAATGG + Intronic
1121508990 14:94498342-94498364 GCTGTTCTCCTCACGGTGAAAGG - Exonic
1121536304 14:94693353-94693375 GCTGTTCTCCTGATAGTGAATGG + Intergenic
1121874312 14:97437385-97437407 GCTGTTCTTGCGACAGTGAATGG + Intergenic
1121937344 14:98032060-98032082 GCTGTTCTCATGATAGTGAATGG + Intergenic
1121991201 14:98559485-98559507 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1122344570 14:101050513-101050535 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1122397713 14:101445725-101445747 ACTGTTTTCCTCAAAGAGAACGG - Intergenic
1123796284 15:23774339-23774361 CCTGTTGTCATGATAGTGAATGG + Intergenic
1124693948 15:31847931-31847953 GCTGTTCTCATGATAGTGAGTGG - Intronic
1125125411 15:36214471-36214493 GCTGTTCTCTTGATAGTGAATGG - Intergenic
1126411618 15:48377817-48377839 GCTGTTTTCATGATAGTGAATGG + Intergenic
1127123838 15:55793431-55793453 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1127129072 15:55843024-55843046 ACTGTTCTCATGATAGTGAATGG + Intronic
1127338420 15:58014053-58014075 ACTTTTTTCATGACAGTGGATGG - Intronic
1127666448 15:61152353-61152375 ACTCTTTTCCTCACAGTGAATGG - Intronic
1127697036 15:61460280-61460302 ACTGATCTCCTGACAGGAATGGG + Intergenic
1128429040 15:67573454-67573476 GCTGTTCTCATGATAGTGAGTGG - Intronic
1128535712 15:68488770-68488792 GCTGTTCTTGTGACAGTGAATGG - Intergenic
1128718491 15:69928053-69928075 GCTGTTCTCATGATAGTGAATGG - Intergenic
1128718751 15:69930001-69930023 GCTGTTCTCATTATAGTGAATGG - Intergenic
1128804899 15:70523393-70523415 GCTGTTCTCCTGATAGTGAGTGG - Intergenic
1130084080 15:80762727-80762749 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1131005085 15:88971440-88971462 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1131114639 15:89786879-89786901 ACTGTTCTTCTCCCACTGAATGG - Intronic
1131642085 15:94303601-94303623 GCTGTTCTCGTGACAGTGAATGG - Intronic
1131773346 15:95765315-95765337 GCTGTTCTCATGATAGTGAGTGG - Intergenic
1131914693 15:97251974-97251996 GCTGTTATCCTGATAGTGAACGG + Intergenic
1133648722 16:7788984-7789006 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1134105000 16:11478854-11478876 GCTGTTCGCGTGATAGTGAATGG + Intronic
1135152801 16:20024217-20024239 GCTGTTGTCATGATAGTGAATGG + Intergenic
1137775198 16:51048408-51048430 ACAGTTCTCCAGACAGAGAGAGG - Intergenic
1137865892 16:51895591-51895613 TCTGCTCTGCTGAGAGTGAATGG + Intergenic
1138401899 16:56752889-56752911 ACTGTTCTTTTCACAATGAATGG - Intronic
1139533463 16:67556400-67556422 ACTGTTCTCCTGAGAATCATAGG + Intergenic
1139726171 16:68900654-68900676 AGTGTTTTCCTGACTTTGAAAGG - Intronic
1140424534 16:74849700-74849722 GCTGTTCTCGTGACAGTGAGTGG + Intergenic
1140566299 16:76046832-76046854 ACTGTTCTCATGACAGTGAATGG - Intergenic
1142286629 16:89174078-89174100 ACTGTTCTTCCCACAGTGGAAGG + Intronic
1144352394 17:14409871-14409893 GCTGTTGTCATGATAGTGAATGG - Intergenic
1144440265 17:15274992-15275014 GCCGTTCTCATGATAGTGAATGG - Intergenic
1145017177 17:19406745-19406767 AGAGTCCTCCTGACAGTCAAAGG - Intergenic
1148600570 17:48891368-48891390 AATGTTCCACTGACAGTAAAAGG - Intergenic
1149214313 17:54336194-54336216 ACTGTTCTTGTGATAGTGAATGG + Intergenic
1149369571 17:55979513-55979535 GCTGTTCTCATGATAGTGAGTGG - Intergenic
1150588831 17:66543178-66543200 ACAGTTTTCTTCACAGTGAATGG + Intronic
1150687528 17:67332518-67332540 GCTATTCTCGTGATAGTGAATGG + Intergenic
1150711597 17:67535026-67535048 ACCCGTGTCCTGACAGTGAAGGG + Intronic
1150892450 17:69168752-69168774 GCTGTTCTCATGATAGTGGATGG + Intronic
1151007833 17:70458666-70458688 GCTGTTCTCGTGATGGTGAATGG - Intergenic
1151045809 17:70918168-70918190 GCTGTTCTCATGATAGTGAGTGG + Intergenic
1151339877 17:73464281-73464303 ACCGTTCTCGTGATAGTGAGTGG + Intronic
1151500857 17:74487875-74487897 GCTGTTCTTCTGATAGTGAATGG - Intergenic
1151501133 17:74489822-74489844 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1151865370 17:76798409-76798431 ACTGATCTCCTGAAAGGGCAGGG - Intergenic
1151930940 17:77230866-77230888 GCTGTTCTCGTGATAGTGAGTGG + Intergenic
1153379319 18:4419220-4419242 GCTGTTCTCATGATAGTAAATGG - Intronic
1154049632 18:10941936-10941958 GCTGTTCTCATGATAGTGAAGGG + Intronic
1154049894 18:10943860-10943882 GCTGTTCTCATGATAGTGAATGG + Intronic
1154064033 18:11089944-11089966 CCTCTTCTCCTTACAGAGAAGGG + Intronic
1154147137 18:11875513-11875535 ACTGTTTTCAAGATAGTGAATGG + Intronic
1155807383 18:30189109-30189131 GCTGTTCTCATGATAGTGAATGG - Intergenic
1155851586 18:30781552-30781574 ACTGTTCTCATGATAGTGAATGG + Intergenic
1156254437 18:35381718-35381740 GCTGTTCTCATGATAGTGAATGG - Intergenic
1156864694 18:41875699-41875721 ACTGTTCCCATGATAGTGAGTGG + Intergenic
1158483905 18:57847566-57847588 GCTGTTCTCATGATAGTGAATGG - Intergenic
1158860966 18:61592023-61592045 GCTGTTCTCTTGATGGTGAATGG + Intergenic
1158887558 18:61842838-61842860 GCTGTTCTTGTGATAGTGAATGG - Intronic
1158918631 18:62164557-62164579 GCTGTTCTCCTGATAGTGAGTGG - Intronic
1159237390 18:65694255-65694277 GCTGTTCTCATGATAGTGCATGG - Intergenic
1159402741 18:67958349-67958371 ACTGTTGTCCTGACAGAATAGGG + Intergenic
1159641342 18:70865673-70865695 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1159650263 18:70970334-70970356 GCTGTTCTCATGATAGTGAATGG - Intergenic
1159718995 18:71861670-71861692 GCTGTTCTCATGATAGTGAATGG - Intergenic
1159762927 18:72451246-72451268 GCTGTTCTCCTGATAGTGAATGG - Intergenic
1159765360 18:72481749-72481771 GCTGTTCTCGTGATAGTAAATGG + Intergenic
1160126997 18:76184507-76184529 AATGTTCTCATGATAGTGAATGG + Intergenic
1160331240 18:77993774-77993796 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1160431340 18:78814883-78814905 ACTGTTCTCCTGGGAGCGAGTGG - Intergenic
1161104958 19:2438717-2438739 GCTGGACTCCTGACAGTGCAGGG - Intronic
1163472034 19:17503113-17503135 GCTGTTCTCATGATAGTGAAGGG - Intronic
1164237700 19:23351480-23351502 TTTCTTCTCATGACAGTGAAAGG - Intronic
1164251590 19:23482159-23482181 TGTCTTCTCGTGACAGTGAAAGG - Intergenic
1164274789 19:23706766-23706788 GCTGTTCTCATGACAGTGAATGG + Intergenic
1164320309 19:24138329-24138351 TTTCTTCTCATGACAGTGAAAGG + Intergenic
1165193755 19:34085334-34085356 ACTGTTCTCCCCACAGTGAGTGG + Intergenic
1166623857 19:44331698-44331720 ACTGTTCACTTGGCAGTGAAAGG - Intronic
1168582462 19:57566917-57566939 GCTGTTCTCCCGACTGTTAAAGG + Intergenic
924991447 2:316071-316093 GCTGTTCTCATGGTAGTGAATGG + Intergenic
925096874 2:1212198-1212220 GCTGTGCTTCTGACAGTGAGTGG + Intronic
925250197 2:2427637-2427659 GCTGTTCTAGTGATAGTGAATGG - Intergenic
925737329 2:6975271-6975293 GCTGTTCTTGTGATAGTGAATGG - Intronic
926377778 2:12250892-12250914 GCTGTTCTCGTGACAGTGAATGG + Intergenic
926607873 2:14915523-14915545 GCTATTCTCATGACAGTGAATGG + Intergenic
926688222 2:15714970-15714992 ACTGTTTTCCTGGTGGTGAATGG - Intronic
926713904 2:15908634-15908656 GCTGTTCTCGTGATAGTGAACGG + Intergenic
927298108 2:21478141-21478163 GCTGTTCTCATGATAGTGAATGG - Intergenic
927461598 2:23304111-23304133 GCTGTTCTCGTGATAGTGAAAGG - Intergenic
928680542 2:33697718-33697740 GCTGTTCTCATGATAGTGAATGG + Intergenic
930263251 2:49171085-49171107 GCTGTTCTTATGATAGTGAATGG + Intergenic
930457367 2:51622490-51622512 GCTGTTCTCATGAGAGTGAATGG - Intergenic
930579594 2:53194566-53194588 GCTGTTCTCGTGATAGTGAATGG - Intergenic
930925362 2:56811314-56811336 GCTGCTCTTATGACAGTGAATGG + Intergenic
931154566 2:59614097-59614119 GCTGTTCTTGTGATAGTGAATGG - Intergenic
932885083 2:75542045-75542067 GCTGTTCTCGTGATAGTGAATGG + Intronic
933038122 2:77426609-77426631 ACTGTTCTTGTGAGAGTGAGTGG + Intronic
933268001 2:80203051-80203073 GCTGTTCTCATGATAGTGAGTGG - Intronic
933852049 2:86375984-86376006 GCTGTTCTCATGATAGTGACTGG + Intergenic
934117943 2:88813487-88813509 GCTGTTCTTGTGATAGTGAATGG + Intergenic
934576962 2:95408626-95408648 GCTGTTCTCATGATAGTGAATGG - Intronic
934639215 2:96017024-96017046 GCTGTTCTCATGATAGTGAATGG - Intergenic
934711158 2:96515097-96515119 GCTGTTCTTGTGATAGTGAATGG - Intergenic
934794434 2:97088387-97088409 GCTGTTCTCATGATAGTGAATGG + Intronic
935094170 2:99927946-99927968 GCTGTTCTCATGATAGTGCATGG + Intronic
935096754 2:99952185-99952207 GCTGTTCTTGTGACAGTGAGTGG + Intronic
935498397 2:103808991-103809013 GCTGTTCTTGTGACAGTGGATGG + Intergenic
935923509 2:108041432-108041454 GCTGTTCTCATGATAGTGAATGG + Intergenic
936289663 2:111211774-111211796 GCTGTTCTCCTGACAGTGAATGG + Intergenic
936344791 2:111667228-111667250 GCTATTCTTCTGATAGTGAATGG - Intergenic
936659126 2:114522890-114522912 GCTGTTCTCATGAGAGTGAATGG - Intronic
936800714 2:116261531-116261553 GCTGTTCTCATGATAGTGAAAGG + Intergenic
936993562 2:118390788-118390810 GTTGTTCTCGTGATAGTGAATGG + Intergenic
937548364 2:123053522-123053544 GCTGTTCTCGTGATAGTGAGTGG + Intergenic
937768275 2:125687429-125687451 ACATTTCTCTTGACTGTGAATGG - Intergenic
939190479 2:138911890-138911912 GCTGTTCTCATGATAGTGAATGG - Intergenic
939436556 2:142184556-142184578 GCTGTTCTCATGATAGTGAATGG - Intergenic
940024427 2:149190660-149190682 GCTGTTCTCATGACATTTAAGGG + Intronic
940179063 2:150912187-150912209 ACTGTGGTCCTCACAGTGACAGG - Intergenic
940543127 2:155046946-155046968 GCTGTTCTTGTGATAGTGAATGG - Intergenic
940552294 2:155175025-155175047 ATAGTTCTCGTGATAGTGAATGG - Intergenic
940554490 2:155206170-155206192 GCTGTTCTCATGATAATGAATGG - Intergenic
940686456 2:156857118-156857140 GCTGTTCTCATGAGAGTGTATGG - Intergenic
941123879 2:161562500-161562522 GCTGTTCTCATGATAGTGAATGG + Intronic
941140718 2:161777689-161777711 GCTGTTCTCGTGACAGTAAATGG - Intronic
941320034 2:164042445-164042467 GCTGTTCTCATGATAGTGAATGG - Intergenic
941423928 2:165319737-165319759 ACTGTTCTCATGGTACTGAATGG - Intronic
942068241 2:172291875-172291897 GCCGTTCTCATGACAGTGAGTGG + Intergenic
942127764 2:172844499-172844521 CCTCTCCTCCTTACAGTGAATGG + Intronic
942508498 2:176669999-176670021 CCTGCTCTCCTGAAAGTAAATGG - Intergenic
943123965 2:183773120-183773142 GCTGTTCTCCTGATAGTGAATGG + Intergenic
943176503 2:184481616-184481638 GCTGTTCTTTTGATAGTGAATGG + Intergenic
943447712 2:188009499-188009521 GCTGTTCTCGTGATAGTGAATGG - Intergenic
943478052 2:188384365-188384387 GCTGTTCTCATGATAGTGAGTGG - Intronic
943478317 2:188386289-188386311 GCTGTTCTCATGATAGTGAGTGG - Intronic
943567683 2:189535771-189535793 TCTGTTTTCCTGCCAGTGGAGGG - Intergenic
943878641 2:193108926-193108948 GCTGTTCTCGTGATAGTGAATGG + Intergenic
943959338 2:194241512-194241534 GCTGTTCTCATGATAGCGAATGG - Intergenic
944721763 2:202429836-202429858 GCTGTTCTCATGACAGTGAGTGG - Intronic
944808732 2:203307646-203307668 GCTGTTCTCCTGATAGTGAATGG + Intergenic
945643953 2:212466469-212466491 GCTGTTCTTATGATAGTGAATGG + Intronic
945769362 2:214021486-214021508 GCTGCTCTCATGACAGTGAATGG - Intronic
946439543 2:219683589-219683611 GCTGTTCTTGTGATAGTGAATGG + Intergenic
946673027 2:222126859-222126881 GCTGTTCTCATGATAGTGAATGG - Intergenic
946882846 2:224193646-224193668 GCTGTTCTCATGATGGTGAATGG - Intergenic
947021096 2:225676643-225676665 GCTGTTCTCGTGATAGTGAATGG - Intergenic
947243931 2:228026013-228026035 ACTGTTCTTGTGATAGTGAGTGG + Intronic
947248277 2:228074526-228074548 ACTGTTCTGGTGATAGTGAGTGG - Intronic
947296302 2:228634857-228634879 GCTGTTCTCATGATAGTGAATGG - Intergenic
947396835 2:229695011-229695033 GCTCTTTTCATGACAGTGAATGG + Intronic
947443313 2:230141956-230141978 GCTGTTCTCATGATAGTGAGTGG + Intergenic
947710702 2:232313915-232313937 GCTGTTCTCATGATAGTGAATGG - Intronic
947825023 2:233100006-233100028 TCTGTTCTCGTGATAGTGAATGG - Intronic
948037116 2:234866640-234866662 GCTGTTCTCATGACAGTGAGTGG - Intergenic
948366281 2:237457041-237457063 CCCTTTCTCCTGTCAGTGAATGG + Intergenic
948409604 2:237749028-237749050 GCTGTTCTCGTGATAGTGAGTGG - Intronic
948760598 2:240188094-240188116 GCTGGTCTCGTGATAGTGAATGG + Intergenic
948851361 2:240708674-240708696 GCTGTTCTCGTGATAGTGAATGG - Intergenic
948878759 2:240844788-240844810 GCTGTTCTCCTGATAGTGAGTGG + Intergenic
1168816579 20:741737-741759 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1169152373 20:3299635-3299657 ACTGTCCTTTTGACATTGAATGG + Intronic
1169484475 20:6016139-6016161 ACTCTTAGACTGACAGTGAAGGG - Intronic
1169836984 20:9891185-9891207 GCTGTTCTCATGATAGTGAATGG - Intergenic
1170037652 20:12005575-12005597 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1170710454 20:18786235-18786257 GCTGTTCTCATGATAGTGAATGG - Intergenic
1171415556 20:24978052-24978074 ACTGTTCTCCAGGCAGTGGGTGG - Intronic
1173098393 20:40060500-40060522 GCTGTTCTCATGATAGTGAATGG + Intergenic
1173389666 20:42621006-42621028 GCTGTTCTCCTGATAGTGAATGG - Intronic
1174121648 20:48270262-48270284 CCAGTTTTCCTGACACTGAAAGG + Intergenic
1174380185 20:50151291-50151313 GCTGTTCTTCAGAGAGTGAAGGG + Intronic
1174636580 20:52006016-52006038 ACTGTTCTCCTGACATAGCCTGG + Intergenic
1174920260 20:54694553-54694575 ACTGTTCTCCTGAGAGTGAACGG - Intergenic
1175674954 20:60938382-60938404 ACTATTCTTCTCAAAGTGAAAGG + Intergenic
1176587626 21:8604103-8604125 CTTGTTCTCCTGATAGTGAGTGG + Intergenic
1176688910 21:9881008-9881030 GCTGTTCTCATGATAGTGAATGG - Intergenic
1176696131 21:9979372-9979394 GCTGTTCTCATAATAGTGAATGG + Intergenic
1176919518 21:14670225-14670247 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1177213641 21:18101125-18101147 GCTGTTCTCATGATAGTGAATGG + Intronic
1177266869 21:18797411-18797433 TCTGTTCTCATGATAGTGAATGG + Intergenic
1177333575 21:19694265-19694287 GCTGTTCTCGTGATAGTGAACGG + Intergenic
1177531475 21:22363642-22363664 ATTGTTCCCCTTACAGGGAACGG - Intergenic
1177839419 21:26219128-26219150 GCTGTTCTCATGATAGTGAATGG + Intergenic
1177851172 21:26350390-26350412 GCTGTTCTCATGATAGTGAATGG + Intergenic
1177972892 21:27812223-27812245 ACTGTTCTCGTGATGGTGAATGG - Intergenic
1178013845 21:28318761-28318783 GCTGTTCTCATGATAGTGAGTGG + Intergenic
1178019320 21:28391480-28391502 GCTTTTCTCATGATAGTGAATGG + Intergenic
1178143823 21:29716016-29716038 GCTGTTCTCATGATAGTGAATGG + Intronic
1178164510 21:29958146-29958168 GCTGTTCTGGTGATAGTGAATGG + Intergenic
1178428370 21:32497874-32497896 GCTGTTGTCTTGATAGTGAAAGG - Intronic
1179065000 21:38016724-38016746 GCTTTTCTCATGATAGTGAATGG + Intronic
1179065269 21:38018653-38018675 GCTGTTCTCATGCTAGTGAATGG + Intronic
1179429694 21:41312022-41312044 GCGGTTCTCATGATAGTGAATGG - Intronic
1180270456 22:10581101-10581123 CTTGTTCTCCTGATAGTGAGTGG + Intergenic
1181383469 22:22525709-22525731 ACTGTCCTCGTGATAGTGAGTGG + Intergenic
1182913633 22:34008064-34008086 GCTGTTCTCGTGATAGTGGATGG - Intergenic
1182938368 22:34248911-34248933 GCTGTTCTCATGATAGTGAGTGG + Intergenic
1183153695 22:36057629-36057651 GCTGTTCTTGTGATAGTGAATGG - Intergenic
949139725 3:617647-617669 CCTGTTCTCCTGATAGTGAGTGG - Intergenic
949301819 3:2592518-2592540 GCTGTTCTCATGATAGTGAATGG + Intronic
950245145 3:11408726-11408748 GCTGTTCTCATGATAGTTAATGG - Intronic
951093212 3:18599039-18599061 GCTGTTCTCATGATAGTGAATGG - Intergenic
951500478 3:23381056-23381078 CCTGTTCTCCTGACTGGAAAGGG + Intronic
951758081 3:26114648-26114670 ACTGTTCTTGTGGTAGTGAATGG - Intergenic
952261165 3:31741822-31741844 ACTGTTTTCATGATGGTGAATGG + Intronic
952844411 3:37674976-37674998 TCTGGTCTCCTGCCAGTGACAGG + Intronic
953358494 3:42274800-42274822 ACTGTTCTGGTAACAGTGAATGG - Intergenic
953461580 3:43085435-43085457 GCTGTTCTCGTGATAGTGAATGG + Intronic
953898152 3:46820011-46820033 GCTGTTCTCGTGATAGTGAATGG + Intergenic
954094090 3:48309357-48309379 ACAGTTATTCTGAGAGTGAATGG - Intronic
954101821 3:48379497-48379519 ACTGCTCTCCTGACAAGAAATGG + Exonic
954516798 3:51185724-51185746 GCTGTTCTCATGATAGTGAATGG + Intronic
954595644 3:51821705-51821727 GCTGTTCTCGTGACAGTAAATGG + Intronic
954897166 3:53985607-53985629 ACTGTTCTGGTGATAGTGAGTGG + Intergenic
955095652 3:55795404-55795426 AGTGTTCTTATGACGGTGAAGGG - Intronic
955471756 3:59294062-59294084 GCTGGTCTCATGATAGTGAATGG - Intergenic
955502094 3:59595592-59595614 GCTGTTCTCATGATAGTGAATGG + Intergenic
955748397 3:62163106-62163128 GCTGTTCCCGTGACAGTGAGTGG - Intronic
956348729 3:68311134-68311156 GCTGTTCTCTTGATAGTGAATGG - Intronic
956534410 3:70259976-70259998 GCTGTTCTCGTGATAGTGAGTGG - Intergenic
956938457 3:74131038-74131060 GCTGTTCTCTTGATAGGGAATGG - Intergenic
956938730 3:74132969-74132991 GCTGTTCTCCTGAGAGTGAATGG - Intergenic
956986879 3:74711815-74711837 ACTGTTCTCGTGACAGCGAGTGG - Intergenic
957240790 3:77658842-77658864 GCTGTTCTCGTGATAGTGAATGG - Intergenic
957247088 3:77729288-77729310 GCTGTTCTCGTGATAGTGAATGG + Intergenic
957459478 3:80497825-80497847 CCTGGGCCCCTGACAGTGAAGGG + Intergenic
957662962 3:83184602-83184624 GCTGTTCTTGTGATAGTGAATGG + Intergenic
957684489 3:83483346-83483368 GCTGTTCTCATGATAGCGAATGG + Intergenic
957759104 3:84532145-84532167 GCTGTTCTCGTGATAGTGAATGG + Intergenic
957785446 3:84876354-84876376 GCTGTTCTCATGATAGTGATTGG + Intergenic
957924318 3:86789034-86789056 ATTGTTCCCCTGAAAGTGAAAGG + Intergenic
957955790 3:87185407-87185429 GCTGTTCTCATGATAGTGAGTGG - Intergenic
958149271 3:89669716-89669738 GGTGTTCTCATGATAGTGAAGGG + Intergenic
958525073 3:95246708-95246730 GCTGTTCTCGTGATAGTGAATGG + Intergenic
958823331 3:99001852-99001874 GCTGTTCTCGTGATAGTAAATGG - Intergenic
958823612 3:99003835-99003857 GCTGTTCTCATAATAGTGAATGG - Intergenic
958847900 3:99287417-99287439 TCTGGTCTCATGATAGTGAATGG + Intergenic
959054594 3:101554620-101554642 GCTGTTCTCATGATAGTGAATGG + Intergenic
959154839 3:102654307-102654329 ATTGTTCTCCTGAATGTGAGGGG - Intergenic
959174052 3:102882697-102882719 GCTGTTCTCATGATAGTGAATGG + Intergenic
959196738 3:103192856-103192878 GCTGTTCTCGTGATAGTGAATGG - Intergenic
959216423 3:103455863-103455885 GCTGTTCTCGTGATAGTGAATGG + Intergenic
959318971 3:104847194-104847216 GCTGTACTTGTGACAGTGAATGG + Intergenic
959741988 3:109731080-109731102 ACTGTTCTCATGACAGTGAATGG - Intergenic
959803467 3:110523848-110523870 GCTGGTCTCGTGATAGTGAACGG + Intergenic
959803692 3:110525760-110525782 GCTGTTCTCGTGATAGTAAATGG + Intergenic
960224423 3:115152695-115152717 GCTGTTCTCATGATAGTGAATGG + Intergenic
960478500 3:118159817-118159839 GCTGTTCTCAAGATAGTGAATGG - Intergenic
960644160 3:119860028-119860050 ATTGTCCTCCTGAGAGTGTAGGG - Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961067658 3:123890120-123890142 GCTGTTCTCATGATAGTGAATGG - Intergenic
962500338 3:135984969-135984991 CCTGTTCTCGTGACAGTGAATGG - Intronic
962916456 3:139908725-139908747 AGTGTTCTCCACTCAGTGAATGG + Intergenic
963011805 3:140776997-140777019 GCAGTTCTCTTGATAGTGAATGG - Intergenic
963280599 3:143381286-143381308 GCTGTTCTTGTGACAGTGAATGG + Intronic
963532297 3:146485932-146485954 GCTGTTCTCATGATAGTGAATGG - Intronic
963815162 3:149821900-149821922 ACTGTTCTTTTGCCATTGAATGG + Intronic
963952705 3:151220583-151220605 GCTGTTCTTGTGATAGTGAATGG + Intronic
963974530 3:151466272-151466294 ACTGTTCTCTTGATTGTAAATGG + Intergenic
964186179 3:153946256-153946278 GCTGTTCTCATGATAGTGAGAGG + Intergenic
964639576 3:158894317-158894339 GCTGTTCTTCTGATAGGGAATGG - Intergenic
964677654 3:159301619-159301641 GCTGTTCTCGTGATAGTGAGTGG + Intronic
964719231 3:159755415-159755437 GCTGTTCTCATGATAGTGAATGG - Intronic
964803307 3:160578471-160578493 GCTGTTCTCATGATAGTGAATGG + Intergenic
965164701 3:165182085-165182107 ATTGTTCTCTTGAAAATGAAAGG - Intergenic
965198497 3:165628483-165628505 TCTGTTCTCATGACAGTGAATGG - Intergenic
965809491 3:172577357-172577379 GCTGTTCTTTTGACAGTGAATGG + Intergenic
965838680 3:172879475-172879497 GCTGTTCTTGTGATAGTGAATGG + Intergenic
965856157 3:173090197-173090219 ACTGTTCTCATGATAGTGAGTGG + Intronic
967255145 3:187583686-187583708 GCTGTTCTCCTGATAGTGAATGG - Intergenic
967396173 3:189011613-189011635 GCTCTTCTCATGATAGTGAATGG - Intronic
967505386 3:190247191-190247213 GCTGTTCTCATGATAGTGAATGG - Intergenic
967528230 3:190518771-190518793 GCTATTCTCGTGATAGTGAATGG - Intronic
969119461 4:4897347-4897369 CCTGTTCTCGTGATAGTGAGTGG - Intergenic
969974316 4:11082325-11082347 GCTGTTCTCATGATAGTGAATGG + Intergenic
970258752 4:14200224-14200246 ACTGTTTTGCTGGCAGTTAAAGG - Intergenic
970329689 4:14966819-14966841 GCTGTTCTCATTACAGTGAATGG - Intergenic
970422372 4:15917315-15917337 ACATTTCTCTTGACTGTGAATGG - Intergenic
970707870 4:18826706-18826728 GCTGTTCTTGTGATAGTGAATGG - Intergenic
970769231 4:19590643-19590665 GCTGTTCTCTTGACAGTGACTGG - Intergenic
970802177 4:19986043-19986065 GCTGTTCTCGTGACAATAAATGG + Intergenic
970838419 4:20438457-20438479 ACTGTTTTCATGATTGTGAATGG - Intronic
971133496 4:23839861-23839883 GCTGTTGTCGTGATAGTGAATGG - Intronic
971299310 4:25428764-25428786 GCTGTTCTCATGATAGTGAATGG - Intergenic
971411681 4:26379585-26379607 GCTGTTCTCATGATAGTGAGTGG - Intronic
971460634 4:26891978-26892000 GCTGTTCTCATGATAGTGAATGG + Intronic
971687588 4:29788565-29788587 GTTGTTCTCATGACACTGAATGG - Intergenic
971844989 4:31906905-31906927 GCTGTTCTTGTGAGAGTGAATGG - Intergenic
972190784 4:36588045-36588067 ACTGTTCTCATGAAAGTGAATGG + Intergenic
972370411 4:38418582-38418604 GCTGTTCTAGTGATAGTGAATGG - Intergenic
972370691 4:38420516-38420538 GCTGTTCTAGTGATAGTGAATGG - Intergenic
972414209 4:38823066-38823088 GCTGTTCTCCTGTTAGCGAATGG - Intronic
972467376 4:39370250-39370272 GCTGTTCTCATGATAGTGAATGG + Intergenic
972467646 4:39372184-39372206 GCTGTTCTCGTAATAGTGAATGG + Intergenic
972849981 4:43036364-43036386 TCTGTTCTTGTGATAGTGAATGG + Intergenic
972913531 4:43848037-43848059 GCTGTTCTCCTAATAGCGAATGG - Intergenic
972935985 4:44136214-44136236 GCTGTTCTTGTGACAGTAAATGG + Intergenic
972987914 4:44787449-44787471 ATTGTTCTCGTGACAGTGAAGGG + Intergenic
973038696 4:45443128-45443150 GCTGTTCTCATGACAATGAATGG + Intergenic
974202669 4:58662078-58662100 GATGTTCTCCTGATAGTGAATGG - Intergenic
974230037 4:59100119-59100141 GCTGTTCTCGTGATGGTGAATGG - Intergenic
974341211 4:60616699-60616721 GCTGTTCTTGTGATAGTGAATGG + Intergenic
974476099 4:62382517-62382539 GCTGTTCTCGTGATAGTGAATGG - Intergenic
975161351 4:71128312-71128334 GCTGTTCTCATGATTGTGAATGG - Intergenic
975200488 4:71582526-71582548 GCTGTTCTTGTGATAGTGAATGG + Intergenic
975390921 4:73816484-73816506 GCTGTTCTCATGATAGTGAATGG + Intergenic
975543178 4:75535150-75535172 GCTGTTCTCATGATAGTGAATGG - Intronic
976368824 4:84263153-84263175 GCTGTTCTCATGATAGTGAGTGG - Intergenic
976440529 4:85068356-85068378 GCTGTTCTTGTGACAGTGAATGG - Intergenic
976515830 4:85965294-85965316 GCTGTTCTCATGATAGTGAATGG - Intronic
976986474 4:91305905-91305927 GCTGTTCTCGTGATAGTGAGGGG - Intronic
976987807 4:91325007-91325029 ATTGTTCTAGTGATAGTGAATGG + Intronic
977369335 4:96115316-96115338 GCTGTTCACCTGACAGTGAATGG - Intergenic
977443082 4:97095179-97095201 GCTGTTCTCATGATAGTGAGTGG - Intergenic
977705523 4:100066430-100066452 GCTGTTCTTGTGATAGTGAATGG - Intergenic
977728727 4:100326716-100326738 GCTGTTCTCGTGATAGTGAATGG - Intergenic
978028053 4:103902315-103902337 GCTGTTCTCATGATAGTGAATGG - Intergenic
978055761 4:104263696-104263718 TCTATTTTCCTCACAGTGAACGG + Intergenic
978059395 4:104317675-104317697 ACTGTTCTTGTGACAGTGAATGG + Intergenic
978392303 4:108240053-108240075 GCTGTTCTCGTGATAGTGAATGG - Intergenic
978704598 4:111691773-111691795 GCTGTTCTCATGATAGTGAATGG - Intergenic
978973802 4:114843909-114843931 ACTGTTCTTTTGATAATGAAGGG + Intronic
979147130 4:117257971-117257993 GCTGTTCTTGTGATAGTGAATGG + Intergenic
979369086 4:119862278-119862300 GCTGTTCTCATGATAGTGAATGG - Intergenic
979389972 4:120117137-120117159 GCTGTTCTCATGATAGGGAATGG - Intergenic
979390259 4:120119076-120119098 GCTGTTCTCATGATAGTGAATGG - Intergenic
979426547 4:120573660-120573682 GCTGTTCTCATGATAGTGAAGGG - Intergenic
979496014 4:121383161-121383183 GATGTTCTCATGATAGTGAATGG + Intergenic
980244784 4:130224644-130224666 ACTGTGCTCCTGCCAGAGAGGGG - Intergenic
980352295 4:131698822-131698844 GCTGTTCTCATGATAGTGAATGG - Intergenic
980366165 4:131807467-131807489 GCTGTTCTCGTGACAGTAATGGG - Intergenic
980368740 4:131839600-131839622 GCTGTTCTCATAATAGTGAATGG + Intergenic
980388416 4:132115585-132115607 GCTGTTCTCATGATAGTGAATGG + Intergenic
981286922 4:143028233-143028255 GATGTTCTCATGATAGTGAATGG + Intergenic
981902987 4:149888712-149888734 GCTGTTCTTGTGATAGTGAATGG - Intergenic
982128123 4:152202005-152202027 ACTGGTCTTCTCACACTGAAAGG - Intergenic
982436551 4:155387550-155387572 GCTGTCCTCGTGATAGTGAATGG - Intergenic
982494298 4:156071146-156071168 GCTGTTCTCATGATAGTGAATGG - Intergenic
982554412 4:156841284-156841306 GCTGTTCTCATGATAGTGAGTGG + Intronic
982758944 4:159257428-159257450 GCTGTTCTCATGATAGTGAATGG - Intronic
982901951 4:161017130-161017152 GCTCTTCTCATGACAGTGAATGG + Intergenic
983669214 4:170216117-170216139 GCTGTTCTCATGATAGTGAATGG + Intergenic
983832258 4:172341615-172341637 GCTGTTCTGGTGATAGTGAATGG + Intronic
984479935 4:180287272-180287294 GTTGTTCTCGTGATAGTGAATGG - Intergenic
984608027 4:181806949-181806971 ACTGTGTGCCTGACAGTGATGGG - Intergenic
984616563 4:181904883-181904905 GCTGTTCTCATGATAGCGAATGG + Intergenic
984811974 4:183803146-183803168 GCTATTCTCATGATAGTGAATGG - Intergenic
985094481 4:186400060-186400082 ACTTTTCTCCTGAGGGTTAAGGG + Intergenic
985304046 4:188520023-188520045 GCTGTTCTTGTGATAGTGAATGG + Intergenic
986473983 5:8106496-8106518 GCTGTTCTGATGATAGTGAATGG + Intergenic
986482637 5:8204245-8204267 ACTGTCCTCATGAGAGTGAGTGG + Intergenic
986756885 5:10845044-10845066 TCTGTTCTCATGATAGTGAATGG - Intergenic
986807346 5:11320695-11320717 GCTGTTCTCATGATAGTGAATGG - Intronic
986839324 5:11678152-11678174 ATTATTTTCCTGATAGTGAAGGG - Intronic
986878968 5:12146969-12146991 GCTGTTCTCGTGATAGTGAGTGG - Intergenic
987128724 5:14840779-14840801 ACTTTCCTACTGACTGTGAAGGG - Intronic
987166624 5:15204629-15204651 GCTGTTCTCATGACAGTGAGTGG + Intergenic
987737002 5:21859385-21859407 GCTGTTCTCATGATAGTGAGTGG - Intronic
987773413 5:22335301-22335323 GCTGTTCTTGTGATAGTGAATGG + Intronic
988212817 5:28227918-28227940 GCTGTTCTCATGATAGTGAATGG + Intergenic
988866811 5:35344126-35344148 GCTGTTCTCATGATAGTGAATGG - Intergenic
988884275 5:35538341-35538363 ACTGTTCTTGTGATAGTGAGTGG + Intergenic
988888201 5:35582408-35582430 GCTGTTCTCATGATAGTGAATGG - Intergenic
988892338 5:35631236-35631258 GCTGTTCTCGTGATAGTGAATGG - Intronic
988898090 5:35700002-35700024 GCTGTTTTCGTGATAGTGAATGG + Intronic
989451706 5:41594395-41594417 AATGTACTTCTGACAGTGATTGG - Intergenic
989675528 5:43968130-43968152 GCTGTTCTCATGATAGTGAATGG + Intergenic
990000804 5:50890171-50890193 ACATTTCTCTTGACTGTGAATGG + Intergenic
990000883 5:50891396-50891418 ACTGTTCTTGTGATAGTGAGTGG - Intergenic
991471094 5:66969863-66969885 AATGTTCTCCACAAAGTGAAAGG - Intronic
991615889 5:68496939-68496961 GCTGTTCTCATAATAGTGAATGG + Intergenic
992517533 5:77510283-77510305 GCTGTTCTTGTGAGAGTGAATGG - Intronic
992826397 5:80553947-80553969 GCTGTTCTCGTGATAGTGAATGG + Intergenic
992854717 5:80848669-80848691 GCTGTTCTCATGACAGTGAATGG - Intronic
993791123 5:92212527-92212549 GCTGTTCTTGTGATAGTGAATGG - Intergenic
994103656 5:95921739-95921761 AGGGTTCTGCTGACAGAGAAGGG + Intronic
994352008 5:98756955-98756977 ACTGTTCTCGTGATAGTGAATGG + Intergenic
994542664 5:101120701-101120723 GCTGTTCTCATGATAGTTAATGG - Intergenic
994542943 5:101122573-101122595 GTTGTTCTCATGATAGTGAATGG - Intergenic
994614111 5:102081811-102081833 GCTGTTCTCATGATAGTGAATGG - Intergenic
994696204 5:103075560-103075582 GCTGTTCTCATGATAGTGAATGG + Intergenic
994746283 5:103682387-103682409 ACTGACCTCCTGTCAGTGAGAGG + Intergenic
994799118 5:104348164-104348186 GCTGTTCTTATGATAGTGAATGG - Intergenic
994813871 5:104558094-104558116 GCTGTTCTCTTGATAGTGAGGGG - Intergenic
994905570 5:105838058-105838080 ACTGTCCTCATGATAGTGATTGG + Intergenic
995428981 5:112053710-112053732 GCTGTTCTCATTATAGTGAATGG + Intergenic
995464022 5:112432190-112432212 GCTGTTCTCGTGATAGTGAGTGG + Intergenic
996214193 5:120847963-120847985 GCTGTTCTTGTGATAGTGAATGG - Intergenic
996297698 5:121942514-121942536 GCTATTCTCATGACAGTGAATGG - Intergenic
996600039 5:125252772-125252794 GCTGTTCTCGTGATAGTAAATGG - Intergenic
996600307 5:125254706-125254728 GCTGTTCTCATGATGGTGAATGG - Intergenic
996768187 5:127056538-127056560 GCTGTTCTTGTGATAGTGAATGG - Intronic
997007523 5:129836084-129836106 ATTGTTCTCCCTGCAGTGAAGGG - Intergenic
997032299 5:130145057-130145079 GCTGTTCTCATGATAGTGAGTGG - Intronic
998004354 5:138647350-138647372 GCTGTTCTGCTGACACTGGATGG + Intronic
998313823 5:141160807-141160829 AATATTCTTCTGACAGTTAAGGG - Intergenic
998565158 5:143210317-143210339 ACTGTTCTCATAATACTGAATGG - Intronic
998715299 5:144876773-144876795 GCTGTTCTAGTGATAGTGAATGG - Intergenic
999412459 5:151364052-151364074 ACATTTCTCTTGACTGTGAATGG + Intergenic
999793845 5:154969212-154969234 GCTGTTCTCGTGATAGTGAGTGG + Exonic
1000034681 5:157436199-157436221 GCTGTTCCTGTGACAGTGAATGG + Intronic
1000213537 5:159132612-159132634 ATTCTTCTGCTGACATTGAAAGG + Intergenic
1000228980 5:159297572-159297594 ACTGTTCTCTTGATAGTGAATGG - Intergenic
1000261836 5:159595826-159595848 GCTGTTCTCATGATAGTGAGTGG - Intergenic
1000493753 5:161951133-161951155 ACATTTCTCTTGACTGTGAATGG + Intergenic
1000639290 5:163682486-163682508 GCTATTCTCATGATAGTGAATGG + Intergenic
1000878621 5:166670709-166670731 ACTGTACCCCTGACTGTGCATGG + Intergenic
1001240461 5:170065716-170065738 GCTGTTCTTGTGATAGTGAATGG - Intronic
1001456256 5:171862615-171862637 ACTGTTGCCCTGACAGTGCATGG - Exonic
1003470395 6:6424587-6424609 ACTGTTCTTGTGATAGTGAATGG - Intergenic
1003649198 6:7943001-7943023 GCTGCTCTCTTGATAGTGAACGG + Intronic
1004575892 6:16894280-16894302 ACATTTCTCTTGACTGTGAATGG - Intergenic
1004703466 6:18101146-18101168 GCTGTTCTCCTGATAGTGAATGG - Intergenic
1005089860 6:22045117-22045139 GCTGTTTTCTTGACAGTAAATGG + Intergenic
1005331459 6:24754663-24754685 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1005794373 6:29342674-29342696 TCTGTTCTCATGACAGTGAGTGG - Intergenic
1005802767 6:29444140-29444162 GCTGTTCTTGTGATAGTGAATGG + Intronic
1006254035 6:32815043-32815065 CCTTTTCTCCCCACAGTGAAGGG + Exonic
1006280217 6:33046496-33046518 GCTGTTCTTGTGACAGTGAATGG + Intergenic
1006696717 6:35937063-35937085 ACTATTCTTGTGATAGTGAATGG + Intergenic
1007440264 6:41853493-41853515 ACTGTACTCTTGAAAATGAAGGG + Intronic
1008248330 6:49206823-49206845 GCTGTTCTCATGATAGTGAATGG - Intergenic
1008248583 6:49208769-49208791 TCTGTTCTTGTGATAGTGAATGG - Intergenic
1009300159 6:62008707-62008729 GCTGTTCTCATGATATTGAATGG + Intronic
1009757450 6:67957386-67957408 GCTGTTCTCGTGATAGTGAGTGG + Intergenic
1009824923 6:68855990-68856012 GCTGTTCTCATGATAGTGAATGG + Intronic
1009876533 6:69512491-69512513 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1010282723 6:74039321-74039343 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1010359640 6:74977895-74977917 ACTGTTTTTCTGAAAGTGATTGG - Intergenic
1010396016 6:75392782-75392804 GCTGTTCTCATGATAGTGAATGG + Intronic
1010511949 6:76730584-76730606 GCTGTTCTCATGATAGTGAATGG + Intergenic
1010558718 6:77320234-77320256 ACTGTTCTCCTAATTGAGAAGGG + Intergenic
1011110761 6:83834529-83834551 GCTGTTCTCATGATAGTGAATGG + Intergenic
1011167975 6:84471583-84471605 GCTATTCTCATGATAGTGAATGG + Intergenic
1011294535 6:85811625-85811647 GCTGTTCTTCTGATAGTGAGTGG - Intergenic
1011895127 6:92215979-92216001 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1012541421 6:100366347-100366369 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1012615757 6:101277895-101277917 ACTGTTTCCCTGTTAGTGAAAGG - Intergenic
1012811800 6:103968086-103968108 GCTGTTCTCATGATAGTGAGTGG - Intergenic
1013039768 6:106421947-106421969 GCTGTTCTCATGATAGTGAATGG - Intergenic
1013227233 6:108128768-108128790 GCTGTTCTCATGATAGTGAGTGG + Intronic
1013417850 6:109940474-109940496 GCTGTTCTCATGGTAGTGAATGG + Intergenic
1013470809 6:110462106-110462128 GCTGTTCTTGTGACAGTAAAAGG - Intronic
1013927596 6:115492535-115492557 GCTGTTCTCATGATAGTGAATGG - Intergenic
1013928004 6:115495630-115495652 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1014067995 6:117149877-117149899 GCTGTTCTCATGATAGTGAATGG - Intergenic
1014068276 6:117151819-117151841 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1014247858 6:119085930-119085952 GCTGTTCTCATGATAATGAATGG - Intronic
1014577193 6:123088066-123088088 AATGTACCCCTGAGAGTGAAAGG - Intergenic
1014579916 6:123124359-123124381 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1014754930 6:125292310-125292332 CCAGTGCTGCTGACAGTGAAGGG - Intronic
1015161678 6:130159180-130159202 GCTGTTCTCATGGTAGTGAATGG + Intronic
1015194571 6:130510908-130510930 GCTGTTCTCCTGATAGTGAAGGG + Intergenic
1015217025 6:130762086-130762108 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1015490819 6:133823658-133823680 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1015660777 6:135571242-135571264 GCTGTTCTCATGATAGTGAATGG + Intergenic
1015873929 6:137803527-137803549 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1016139602 6:140592978-140593000 GCTGTTCTCATGAAAGTAAATGG + Intergenic
1016358791 6:143246443-143246465 GCTGTTCTTGTGATAGTGAATGG - Intronic
1016537494 6:145125280-145125302 GCTGTTCTCATGATAGTGAATGG + Intergenic
1016537760 6:145127219-145127241 GCTGTTCTCATGATAGTGAATGG + Intergenic
1016625565 6:146163491-146163513 ACTGTACTCCGTACATTGAAAGG - Intronic
1016649467 6:146447665-146447687 GCTGTTCTCATGATAGTGAATGG - Intergenic
1016649733 6:146449594-146449616 GCTGTTCTCATGATAATGAATGG - Intergenic
1016862155 6:148731469-148731491 GCTGTTCTCATGATAGTGAATGG + Intergenic
1017062140 6:150493732-150493754 ACTGTTCCCATGACAGTGAATGG + Intergenic
1017076995 6:150628383-150628405 TCTGCTCTTCTTACAGTGAAGGG - Intronic
1017342173 6:153336507-153336529 GCTGTTCTCATGATAGTGAATGG + Intergenic
1017424608 6:154307254-154307276 GCTGTTCTCATGATAGTGAATGG + Intronic
1017532296 6:155307483-155307505 GCTGTTCTCATGATAGTGGATGG - Intronic
1017601908 6:156092589-156092611 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1018473022 6:164113082-164113104 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1018857963 6:167689041-167689063 ACTGGTCTCCGGTCAGTGAATGG + Intergenic
1020581659 7:10010716-10010738 AGTGTTCTCATGACAGTGAGTGG + Intergenic
1020782578 7:12535403-12535425 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1021036712 7:15809109-15809131 ACTGTTCTCGTGATAGTGAATGG - Intergenic
1021570842 7:22063498-22063520 GCTGTTCTCGTGATAGTGAGTGG + Intergenic
1021621464 7:22554309-22554331 GCTGTTCTCATGATAGTGAAGGG - Intronic
1022458061 7:30576704-30576726 GCTGTTCTCATGATAGCGAATGG - Intergenic
1022701818 7:32768592-32768614 ACTGTTCTTGTGATAGTGAATGG - Intergenic
1022906050 7:34858750-34858772 GCTGTTCTTGTGATAGTGAATGG - Intronic
1023188289 7:37553536-37553558 GCTGTTCTCCTGATAGTGAATGG - Intergenic
1023265098 7:38396276-38396298 GCTGTTCTCATGATAGTGACTGG + Intronic
1023619577 7:42055967-42055989 TCTGTTCTCCTGATGTTGAATGG + Intronic
1023709645 7:42977858-42977880 GCTGTTCTCATGACAGTGAGTGG + Intergenic
1023969733 7:44981907-44981929 AATTTACTACTGACAGTGAATGG - Intergenic
1024328202 7:48130146-48130168 TCTGTTCTCGTGATAGTGAATGG - Intergenic
1024384900 7:48739596-48739618 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1024845330 7:53635541-53635563 GCTGTTCTCATGATAATGAATGG + Intergenic
1025153160 7:56576488-56576510 TTTCTTCTCATGACAGTGAAAGG + Intergenic
1027814137 7:82947198-82947220 TCTGTTCTCCTGAAAGTGTCAGG - Intronic
1027913554 7:84284306-84284328 CTAGTTCTCCTGACAGTCAAAGG + Intronic
1027968437 7:85043695-85043717 GCTGTTCTCGTGATAGTGAATGG + Intronic
1028042048 7:86064677-86064699 GCTGTTCTCATGATAGTGAATGG + Intergenic
1028250214 7:88531321-88531343 GCTGGTCTCGTGATAGTGAATGG + Intergenic
1028314613 7:89384547-89384569 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1028348505 7:89814065-89814087 GCTGTTCTCATGATAGAGAATGG - Intergenic
1028359875 7:89955186-89955208 GCTGTTCTCATGATAGTGAATGG - Intergenic
1028360152 7:89957122-89957144 GCTGTTCTCATGATAGTGAATGG - Intergenic
1028458382 7:91062942-91062964 AATGTCCTTCTTACAGTGAAAGG + Intronic
1028817790 7:95167247-95167269 GCTGTTCTTGTGATAGTGAATGG - Intronic
1029525179 7:101089561-101089583 TCCGTTCTCCGGACAGTTAAAGG + Exonic
1030412946 7:109204557-109204579 CCTGTTCTCATGATAGTGAATGG - Intergenic
1030783011 7:113624985-113625007 GCTCTTCTCGTGACAGTGAATGG - Intergenic
1030904146 7:115162236-115162258 GCTGTTCTCATGATAGTGAATGG - Intergenic
1031177467 7:118371226-118371248 GCTGTTCTCGTGACAGTGAATGG - Intergenic
1031301488 7:120067027-120067049 GCTGTTCTCATGATAGTGAATGG + Intergenic
1031301745 7:120068955-120068977 GCTGTTCTCATGATAGTGAATGG + Intergenic
1031650604 7:124284968-124284990 GCTGTTCTCATGATAGTGAGAGG + Intergenic
1031729205 7:125277081-125277103 GCTGTTCTCATGATAGTGTATGG + Intergenic
1032006268 7:128304523-128304545 ACTGCTATCCTGACAGAGATGGG + Exonic
1032110018 7:129068131-129068153 ACTTTTCCCCTTACAGTGAGCGG - Intergenic
1032442998 7:131956475-131956497 GCTGTTCTCGTGATAGTAAATGG + Intergenic
1033000755 7:137501934-137501956 GCTGTTCTCATGATAGTGAATGG + Intronic
1033036335 7:137879416-137879438 CCTGTTTTCATGACAGAGAAGGG - Exonic
1033224839 7:139553253-139553275 GCTGTTCTCATGATGGTGAATGG + Intergenic
1033717612 7:144018997-144019019 GTTGTTCTCATGATAGTGAATGG - Intergenic
1033805254 7:144946862-144946884 GCTGTTCTCATGATAGTGAATGG - Intergenic
1034052086 7:147994546-147994568 ACTGTTCTCATGATAGTGAATGG + Intronic
1034689149 7:153000133-153000155 GCTGTTCTCATGATAGTGAGGGG - Intergenic
1034739551 7:153461434-153461456 ACTGTTCTCTTGGTAGTGAATGG + Intergenic
1035469514 7:159100693-159100715 ACTGTTCTTGTGGTAGTGAACGG + Intronic
1035469520 7:159100745-159100767 ACTGTTCCTGTGATAGTGAACGG + Intronic
1035469530 7:159100797-159100819 ACTGTTCCTGTGATAGTGAACGG + Intronic
1035469538 7:159100852-159100874 ACTGTTCCTGTGATAGTGAATGG + Intronic
1035469556 7:159100959-159100981 ACTGTTCCTGTGATAGTGAACGG + Intronic
1035469590 7:159101173-159101195 ACTGTTCCTGTGATAGTGAACGG + Intronic
1035469600 7:159101228-159101250 ACTGTTCCTGTGATAGTGAACGG + Intronic
1035469610 7:159101283-159101305 ACTGTTCCTGTGATAGTGAACGG + Intronic
1035469690 7:159101763-159101785 ACTGTTCCTGTGACAGTGAACGG + Intronic
1035469729 7:159102026-159102048 ACTGTTCCTGTGATAGTGAACGG + Intronic
1035469758 7:159102188-159102210 ACTGTTCCTGTGATAGTGAACGG + Intronic
1035469765 7:159102240-159102262 ACTGTTCCTGTGATAGTGAATGG + Intronic
1036100902 8:5783585-5783607 ACTGTTCTCCTGGAAGTAAATGG + Intergenic
1036123291 8:6040907-6040929 GCTGTTCTCATGACAGTGAATGG - Intergenic
1036914409 8:12790900-12790922 ACTGTTCTCGTGATAGTGAATGG - Intergenic
1037200855 8:16250538-16250560 GCTGTTCTTGTGACAGTGAATGG - Intronic
1037298643 8:17428060-17428082 GCTGTTCTCATGATAGTGAATGG - Intergenic
1038746741 8:30261416-30261438 GCTCTTCTCGTGATAGTGAATGG + Intergenic
1038814287 8:30885317-30885339 GCTATTCTCATGATAGTGAATGG + Intronic
1039121804 8:34156409-34156431 GCTGTTCTCATGATAGTGAATGG + Intergenic
1039122080 8:34158350-34158372 GCTGTTCTCGTGACAGTGAATGG + Intergenic
1039148557 8:34478310-34478332 CCTGTTCTCCTGATAGTGAGTGG - Intergenic
1039185849 8:34915501-34915523 GCTGTTCACTTGATAGTGAAGGG + Intergenic
1040802047 8:51352502-51352524 GCTGTTCTCATGATAGTGAGGGG + Intronic
1040966187 8:53083075-53083097 GTTGTTCTCATGATAGTGAATGG + Intergenic
1041312019 8:56526693-56526715 GCTGTTCTTGTGACAGTGAGAGG - Intergenic
1041443021 8:57918908-57918930 GCTGTTCTCTTGATAGTGAATGG - Intergenic
1041551119 8:59102567-59102589 GCTGTTCTTGTGATAGTGAACGG - Intronic
1041953905 8:63536531-63536553 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1041953910 8:63536566-63536588 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1042428522 8:68676943-68676965 GCTCTTCTCATGATAGTGAATGG - Intronic
1042462070 8:69081057-69081079 CTTGTTCTCATGATAGTGAATGG + Intergenic
1042660915 8:71153528-71153550 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1042684478 8:71422778-71422800 GCTGTTCTCCTGATAGTGATGGG - Intronic
1043078943 8:75740232-75740254 GCTGTTTTCATGATAGTGAATGG - Intergenic
1043080732 8:75761566-75761588 ACTGTTCTCGTAAAAGTGAATGG + Intergenic
1043492352 8:80762497-80762519 GCTGTTCTCGTGACAGTGAGTGG - Intronic
1043518421 8:81018568-81018590 GCTGTTCTCATGATGGTGAATGG + Intronic
1044043302 8:87397840-87397862 GTTGTTCTCATGATAGTGAATGG + Intronic
1044181807 8:89205476-89205498 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1045093268 8:98769351-98769373 GCTGTTCTCATGATAGTGAATGG + Intronic
1045249434 8:100471024-100471046 ACTGTTCTCATGATAGTGAATGG + Intergenic
1045939931 8:107727670-107727692 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1046003409 8:108448479-108448501 GCTGTTCTCATTATAGTGAATGG + Intronic
1046061686 8:109147643-109147665 ACTTTTCTCAAGAGAGTGAAAGG + Intergenic
1046130575 8:109962933-109962955 ACTTGTCTCCGGATAGTGAATGG + Intergenic
1046851987 8:118984955-118984977 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1047149023 8:122240228-122240250 GCTGTTCTCATGATAGTGAATGG + Intergenic
1047364465 8:124199590-124199612 GCTGTTCTCCTGACAGATCATGG + Intergenic
1047513454 8:125532942-125532964 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1047920608 8:129630822-129630844 GCTGTTCTCATGACAGTGAATGG - Intergenic
1048027667 8:130601524-130601546 GCTGTTCTAGTGACAGTGAATGG + Intergenic
1048137873 8:131763866-131763888 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1048234856 8:132679694-132679716 TCTGTTCTCGTGATAGTAAATGG + Intergenic
1048591989 8:135828840-135828862 GCCGTTCTCCTAATAGTGAATGG + Intergenic
1048769592 8:137881625-137881647 CTTGTTCTCCTGATAGTGAATGG + Intergenic
1048907559 8:139103193-139103215 GCTGTTCTCATGATAGTGAATGG - Intergenic
1049863001 8:144913192-144913214 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1050337674 9:4605185-4605207 CCTGTTGTCCTGAGATTGAATGG - Intronic
1050830054 9:9999199-9999221 ACTGTTCTTTTGACAGTTACAGG + Intronic
1051015989 9:12475802-12475824 GCAGTTCTCATGACAGTGAATGG + Intergenic
1051070181 9:13156542-13156564 GCTGTTCTCCTGATAGTAAATGG - Intronic
1051394601 9:16606487-16606509 GCTATTCTCTTGACAGTGAATGG + Intronic
1051560472 9:18435834-18435856 GCTGTTCTCGTGATAGTGAATGG - Intergenic
1051743466 9:20273509-20273531 GCTGTTCTCATGATAGTGAATGG + Intergenic
1051837253 9:21354250-21354272 GCTGTTCTCATGATAGTGAATGG + Intergenic
1051957325 9:22712165-22712187 ACTGTTCTCATGATAGTGAATGG + Intergenic
1052006858 9:23359949-23359971 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1052599181 9:30601538-30601560 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1053118346 9:35525407-35525429 AGTGGTCTCCTGACAGTGTAGGG + Intronic
1053632846 9:39963418-39963440 GCTGTTCCCATGATAGTGAATGG + Intergenic
1053633110 9:39965324-39965346 GCTGTTCTCATAATAGTGAATGG + Intergenic
1053772641 9:41498209-41498231 GCTGTTCTCATAATAGTGAATGG - Intergenic
1053772912 9:41500115-41500137 GCTGTTCCCATGATAGTGAATGG - Intergenic
1053780417 9:41600892-41600914 GCTGTTCTCATGATAGTGAATGG + Intergenic
1053894511 9:42730124-42730146 GCTGTTCTCATGATAGTGAATGG - Intergenic
1054168359 9:61811049-61811071 GCTGTTCTCATGATAGTGAATGG + Intergenic
1054210778 9:62285373-62285395 GCTGTTCTCATAATAGTGAATGG - Intergenic
1054211042 9:62287279-62287301 GCTGTTCCCATGATAGTGAATGG - Intergenic
1054669170 9:67769769-67769791 GCTGTTCTCATGATAGTGAATGG - Intergenic
1055025310 9:71713232-71713254 GCTGTTCTCATGACAGTGAATGG + Intronic
1055083630 9:72291827-72291849 GCTGTTCTCATGATAGTGAATGG - Intergenic
1055525815 9:77132699-77132721 GCTGTTCTCATGATAGTGAGTGG + Intergenic
1056083313 9:83119776-83119798 GCTGTTCTTATGATAGTGAATGG + Intergenic
1056103167 9:83319723-83319745 GCTGTTCTCTTGATAGTGAATGG + Intronic
1056297564 9:85207751-85207773 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1056475904 9:86950699-86950721 GCTGTTTTCATGACAGTGAATGG - Intergenic
1057425902 9:94949423-94949445 TCTGTCCTCCTGAGAGTGAAAGG - Intronic
1058071341 9:100603427-100603449 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1058082376 9:100713582-100713604 GCTGTTCTCGTGAGAGTGAGTGG - Intergenic
1058274703 9:103024924-103024946 GCTGTTCTCATGACAGTGAATGG + Intergenic
1058309868 9:103486366-103486388 CCTGTTCTCGTGATAGTGAGTGG + Intergenic
1058764625 9:108169370-108169392 ACTGTTCTTGTGATAGTGAATGG + Intergenic
1058924170 9:109645305-109645327 GCTGGTCTCATGATAGTGAATGG - Intronic
1059040837 9:110814016-110814038 GCTGTTCTCCTGATAGTGAATGG - Intergenic
1059235321 9:112755810-112755832 CTTGTTCTCATGCCAGTGAAGGG + Intronic
1059474660 9:114535491-114535513 GCTGTTCTCCTGACAGTGAGTGG - Intergenic
1059559514 9:115319574-115319596 GCTGTTCTTGTGATAGTGAATGG + Intronic
1059562570 9:115349213-115349235 GCTGTTCTCATGATAGTGAGTGG - Intronic
1060197154 9:121631235-121631257 TCTGAACTCCTGACAGTGCAGGG - Intronic
1060706925 9:125811441-125811463 CCTGTTCTCATGATAGTGAATGG + Intronic
1061406875 9:130397279-130397301 GCTGATCTCGTGATAGTGAATGG - Intronic
1061961155 9:133990062-133990084 ACTGTTCTCATGACAGAGATGGG + Intronic
1062251486 9:135597868-135597890 GCTGATCTCCTGACAGTGAATGG + Intergenic
1203617593 Un_KI270749v1:82281-82303 CTTGTTCTCCTGATAGTGAGTGG + Intergenic
1185918971 X:4067864-4067886 GCTGTTCTCATGATAGTGAGGGG + Intergenic
1186251223 X:7668981-7669003 GCTGTTCTGTTGATAGTGAATGG - Intergenic
1187030286 X:15480102-15480124 GCTGTTCTTGTGACAGTGAATGG + Intronic
1187196492 X:17090403-17090425 GGTGTTCTCGTGATAGTGAATGG - Intronic
1187423157 X:19154169-19154191 GCTGTTCTCATGATAGTCAATGG + Intergenic
1187793143 X:22972612-22972634 AATGTTTTTCTTACAGTGAAGGG + Intergenic
1188029764 X:25251329-25251351 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1188297900 X:28472325-28472347 GCTGTTCTCGTGATAATGAATGG - Intergenic
1188397776 X:29706119-29706141 GCTGTTCTCGTGATACTGAATGG - Intronic
1188513517 X:30961246-30961268 GCTGTTCTCGTGATAGTGAGGGG + Intronic
1188912528 X:35866912-35866934 GCTGTTCTCTTGATAGTGAATGG + Intergenic
1188937100 X:36190095-36190117 ACTGTTCACCTGGGAGTGAAAGG + Intergenic
1189071156 X:37865793-37865815 GCTGTTCTCATGACAGTGAGTGG - Intronic
1189537819 X:41954871-41954893 GCTGTTCTTGTGATAGTGAATGG - Intergenic
1189945175 X:46170674-46170696 GCTGTTCTCATGAGAGTGAATGG - Intergenic
1189945456 X:46172631-46172653 GCTGTTCTCGTGACAGTGAATGG - Intergenic
1190248181 X:48704551-48704573 ACTGTTCTCCAGGAGGTGAAGGG + Intronic
1190591253 X:52003997-52004019 ACTGCTCTCCTCACAGTGTTTGG - Intergenic
1191736515 X:64394179-64394201 GCTGTTCTTGTGATAGTGAATGG - Intronic
1192161014 X:68787500-68787522 ACTGTTCTACTGTCACAGAAAGG + Intergenic
1193452039 X:81683550-81683572 GCTGTTCTCATGATAGTGAATGG + Intergenic
1193519416 X:82510994-82511016 GCTGTTTTCATGATAGTGAATGG - Intergenic
1193625381 X:83813856-83813878 GCTGTTCTCGTGGCAGTGAATGG + Intergenic
1193917503 X:87383090-87383112 GCTGTTCTCATGATAGTGAATGG + Intergenic
1194018193 X:88652491-88652513 GCTGTTCTCATGATAGTGAGTGG - Intergenic
1194081740 X:89475519-89475541 ACTGTTCTCGTGATAGTGAATGG + Intergenic
1194216115 X:91132443-91132465 GCCGTTCTCGTGATAGTGAATGG + Intergenic
1194269614 X:91794886-91794908 GCTGTTCTCATGATAGTGAATGG + Intronic
1194283677 X:91983638-91983660 ACTGTTCTCCTGACAGTGAATGG - Intronic
1194364272 X:92995303-92995325 ACTGTTGTCATGATGGTGAATGG + Intergenic
1194392643 X:93339643-93339665 ACACTTCTCTTGACTGTGAATGG - Intergenic
1194518965 X:94894826-94894848 GCTGGTCTCGTGATAGTGAATGG + Intergenic
1194662253 X:96640024-96640046 CCTGTTCTCATGATAGTGAATGG + Intergenic
1194961677 X:100243449-100243471 GCTATTCTCGTAACAGTGAATGG - Intergenic
1195558479 X:106255257-106255279 GCTGTTCTCGTGGTAGTGAATGG - Intergenic
1195560565 X:106277640-106277662 GCTGTTCTCCTGATAGTGAATGG - Intergenic
1195561397 X:106288699-106288721 GCTGTTCTCCTGATAGTGAATGG + Intergenic
1195670929 X:107469381-107469403 GCTGTTCTCATGATAGTGAATGG - Intergenic
1195788433 X:108554405-108554427 ACTGTTCTCCTGATAGTGAGTGG - Intronic
1196008188 X:110857397-110857419 GCTGTTCTCATGACAGTGAATGG + Intergenic
1196125329 X:112092711-112092733 ATTGTTCTCATGATAGTGAATGG + Intergenic
1196222703 X:113130105-113130127 ATTGTTCACCTAACAGTGAAGGG + Intergenic
1196579526 X:117362368-117362390 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1197040293 X:121928834-121928856 GCTGTTCTTATGACAGTGAGTGG + Intergenic
1197301843 X:124790137-124790159 GCTGTTCTCATGATAGTGCATGG - Intronic
1197610777 X:128635808-128635830 GCTGTTCTCGTAATAGTGAATGG - Intergenic
1198614302 X:138438599-138438621 GCTGTTCTCATGATAGTTAATGG - Intergenic
1198793511 X:140371356-140371378 GCTGTTCTTGTGATAGTGAATGG + Intergenic
1199100075 X:143789479-143789501 GCTGTTCTCTTGACAGTGAATGG - Intergenic
1199472388 X:148209428-148209450 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1199491162 X:148402280-148402302 GCTGTTCTCATGACAGTGAATGG - Intergenic
1199868647 X:151876895-151876917 GCTGTCCTCCTGATAGTGAATGG - Intergenic
1199934873 X:152562754-152562776 GCTGTTCTCGTGATAGTGAATGG + Intergenic
1200434408 Y:3131709-3131731 ACTGTTCTCGTGATAGTGAATGG + Intergenic
1200586836 Y:5015867-5015889 GCTGTTCTCATGATAGTGAATGG + Intronic
1200601248 Y:5208202-5208224 ACTGTTCTCCGGACAGTGAATGG - Intronic
1200672505 Y:6111568-6111590 ACTGTTCTTATGATGGTGAATGG + Intergenic
1201344559 Y:12968270-12968292 GCTATTCTGCTGATAGTGAATGG - Intergenic
1201467017 Y:14293588-14293610 GCTGTTCTCATGATAGTGAATGG - Intergenic
1201923981 Y:19265277-19265299 GCTATTCTCATGATAGTGAATGG - Intergenic
1201924200 Y:19267109-19267131 GCTGTTCTCATGACAGTTAATGG - Intergenic