ID: 1194284553

View in Genome Browser
Species Human (GRCh38)
Location X:91993798-91993820
Sequence CTTCCCTTCTCCTTGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 7, 3: 48, 4: 390}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194284551_1194284553 -9 Left 1194284551 X:91993784-91993806 CCTGTTAGGGTCTTCTTCCCTTC 0: 1
1: 1
2: 0
3: 10
4: 199
Right 1194284553 X:91993798-91993820 CTTCCCTTCTCCTTGGCTGCAGG 0: 1
1: 0
2: 7
3: 48
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194284553 Original CRISPR CTTCCCTTCTCCTTGGCTGC AGG Intronic
900302791 1:1986373-1986395 GTTCCCTTGCCCCTGGCTGCTGG + Intronic
900367799 1:2318326-2318348 CGTCCCTTCACCCTGGCTTCTGG - Intergenic
900783211 1:4631329-4631351 CTGCCCTTGTCCTCGGCTTCTGG - Intergenic
901075882 1:6554445-6554467 CTGCCGTTCCACTTGGCTGCGGG - Exonic
901628405 1:10636257-10636279 CCTCTCCTCTCCTGGGCTGCTGG - Intergenic
902079857 1:13813593-13813615 CTTCCTACCTCCTGGGCTGCTGG + Intronic
902797118 1:18807176-18807198 CTTCCCTCCTCCTGTGCTCCTGG - Intergenic
903264016 1:22145738-22145760 CTTGCCTTCTCCTGGGGTGCTGG + Intergenic
903867697 1:26410969-26410991 CCTCCCTTCTACGTGGCTCCTGG - Intronic
903885116 1:26536606-26536628 CTTCCCTTCTCCCTGGGAGGAGG + Intronic
904644816 1:31957760-31957782 CTTCTCTCTTCCTTGGTTGCTGG + Intergenic
905018211 1:34791956-34791978 CTTCCCTTCCACTTGGCTAATGG + Intronic
905935844 1:41823557-41823579 CCTGACTTCTCCCTGGCTGCTGG + Intronic
906048260 1:42849761-42849783 CTTTCCCTGTCCTTGGCTGTAGG + Intronic
906153469 1:43600970-43600992 CTTCCAGTCTCCTTGCCTGCGGG - Intronic
906536836 1:46555408-46555430 CCTCCCTGGTCCTTGGCTCCGGG - Intergenic
906889774 1:49696825-49696847 TTTCCCTTTGCTTTGGCTGCTGG - Intronic
908416105 1:63914848-63914870 CTTCCATGCACCTTGGCTGATGG + Intronic
910521599 1:88128011-88128033 CCTCACTTCTCCTTGAGTGCGGG + Intergenic
911056922 1:93716784-93716806 CTCCCCTCCTCATTGGCTGAGGG + Intronic
911520832 1:98927826-98927848 CTTCCCTTCCCCTAGGTTGGTGG + Intronic
912254989 1:108049159-108049181 CTTCCCTTGTCCTTCTTTGCAGG - Intergenic
912979120 1:114354737-114354759 CTTCCATTCTCCTGGGCATCAGG - Intergenic
913314333 1:117537335-117537357 ACTCCCTTCTCCTTGGTTTCTGG - Intergenic
915568126 1:156728220-156728242 CATCCCTTTCCCTTGGCTCCAGG + Exonic
916125074 1:161562583-161562605 CTTCCCTTCTTCTTTGCTAACGG + Intergenic
916134966 1:161643929-161643951 CTTCCCTTCTTCTTTGCTAACGG + Intronic
916480284 1:165208530-165208552 CTTTCCTCCTCCCTGTCTGCTGG + Intronic
916886883 1:169078172-169078194 CTTCCCTTCCCTTTGCCTTCAGG + Intergenic
917466176 1:175278396-175278418 CTTACCTTCTCGCTTGCTGCTGG - Intergenic
919301361 1:195771019-195771041 CTTGCAGTCTCCTTGCCTGCCGG - Intergenic
920358180 1:205391652-205391674 CCTCCTTACTCCTGGGCTGCTGG - Intronic
920458096 1:206116410-206116432 CATCGCTGCTCCCTGGCTGCTGG - Exonic
921516181 1:216095478-216095500 CTTCCTTTCCCTCTGGCTGCAGG + Intronic
921999379 1:221459760-221459782 CCTGCCTTGTCCTTGGCTGGAGG - Intergenic
922344146 1:224682067-224682089 GGTCTCTTCTCCTTAGCTGCAGG + Intronic
922526537 1:226308796-226308818 CTTCCCTCCACCTCGGCTGGGGG + Intronic
923297129 1:232604899-232604921 CTGGCCATCTCCTTGGCTTCTGG - Intergenic
923540511 1:234885102-234885124 CTTCCCTAACCCTTGGCTGCAGG + Intergenic
1063547676 10:6998253-6998275 ATTAACTTCTCCTTGGCTGAAGG + Intergenic
1064151556 10:12869902-12869924 TTTCCCTTCTCACTGGCTGGGGG - Intergenic
1064155232 10:12898245-12898267 CTTGCTTTCCCCTTGGGTGCTGG - Exonic
1064919497 10:20501291-20501313 TTTCACTTCTCCTTGGCCCCTGG + Intergenic
1065485108 10:26229715-26229737 ATTCCTTTCTCCTTGACTTCTGG - Exonic
1065771923 10:29085835-29085857 CTTCCTTTCCCCATGGCTGGGGG - Intergenic
1067785340 10:49241785-49241807 CATCTCTTCTCCATGGCTGCTGG - Intergenic
1069618952 10:69824538-69824560 CTTCTCTTCTCCCTGCCTGCTGG + Intronic
1071630243 10:87213896-87213918 ACTCCCTCCTCCTTGCCTGCAGG - Intergenic
1072609855 10:97010905-97010927 CTTTCCTTCGCCATGGCTGGAGG + Intronic
1073010384 10:100354556-100354578 CTCCCCTTCTCTTTGACAGCTGG - Exonic
1073262879 10:102203794-102203816 TTTTCCTTGTCCCTGGCTGCAGG + Intergenic
1073495002 10:103882826-103882848 CAGCCCTTCTCCATGTCTGCAGG + Exonic
1074050035 10:109873362-109873384 CTTACCTTCTCGTAGGCTGTAGG + Exonic
1075566598 10:123509513-123509535 ATTCCCTTCTCCTTTCCTCCTGG + Intergenic
1075649714 10:124119488-124119510 CTGCTCTTCACCCTGGCTGCTGG + Intergenic
1076509211 10:131000092-131000114 CTTCCATTCTCCTTGGCAGCAGG - Intergenic
1076542759 10:131224446-131224468 CTTCCCTTCCCCTAGGCTCTAGG + Intronic
1076806464 10:132861581-132861603 CTGCCCAGCTCCCTGGCTGCAGG - Intronic
1077232782 11:1465581-1465603 CTTTCATTCCCCTTTGCTGCTGG + Intergenic
1078682066 11:13486474-13486496 CTCCTCTCCTCCTTGGCTACTGG + Intergenic
1079164665 11:18028642-18028664 CTTTCCTCTACCTTGGCTGCAGG + Intronic
1079243226 11:18735393-18735415 TCTCCCTTCTCCTTGTCTGCAGG + Intronic
1079384758 11:19968919-19968941 CTTGGCTTCTCCTTGTCCGCAGG + Intronic
1079987762 11:27216395-27216417 CCTCCCTTCTCCTGAGCAGCTGG + Intergenic
1083116762 11:60467597-60467619 CTTCCCTGCTGCTTGACTTCAGG + Intronic
1084287424 11:68141233-68141255 TTTCCCTGCTCTGTGGCTGCAGG + Intergenic
1084928119 11:72530618-72530640 CTTCCATTCTCCTGGGCATCAGG + Intergenic
1085303138 11:75470122-75470144 CTTTCCTTCCACTTTGCTGCAGG - Intronic
1085700470 11:78741123-78741145 CTTCCCATCTCCTTTGTTCCAGG - Intronic
1085756878 11:79209186-79209208 CTTCCCTACTCCGAGGATGCAGG + Intronic
1087693784 11:101352420-101352442 CTTGTCTTCTCCTTGCCTGTAGG - Intergenic
1090467162 11:126944778-126944800 ATTCCCTTCTCCATTGCTCCTGG + Intronic
1090595358 11:128315145-128315167 CTTGCCTTCTGCATAGCTGCAGG + Intergenic
1093112578 12:15169408-15169430 CCTTCCTTCTTCTTGGCTTCTGG - Intronic
1095986053 12:48000559-48000581 CTTCTCTGCTCCTGGGCTGGTGG - Intronic
1096041767 12:48523543-48523565 CTTCTCTCCAACTTGGCTGCAGG - Intronic
1096353785 12:50922845-50922867 CTTTCATTCTCCTTTGCTGAGGG + Intergenic
1096807337 12:54148756-54148778 CTTCCCTCCACCTTGGCTGCTGG + Intergenic
1096812598 12:54181229-54181251 TTTCCCTTCACCCTGGCCGCAGG + Intronic
1099614105 12:84912886-84912908 CTACCCTTCTCCTCTGCAGCCGG - Intronic
1100797842 12:98201322-98201344 CTCCTCTTCTCCTTTGCTGCTGG + Intergenic
1101154727 12:101916693-101916715 CTTTACTTCTCCTTTGCTGGAGG - Intronic
1101560526 12:105853385-105853407 CTTCCCTTCTCCTTCTTGGCAGG - Intergenic
1102391551 12:112552969-112552991 CTTCTCTTCCCCATGCCTGCTGG + Intergenic
1102755445 12:115335782-115335804 CTTCCCTCCTTCTGGGCTGCTGG - Intergenic
1104067469 12:125317484-125317506 CTTGCCTTTTCCTGGGCTGGGGG + Intronic
1104094889 12:125548069-125548091 CTTCCCTTCTCTGTGGCCCCAGG - Intronic
1104519406 12:129459117-129459139 TTTCCCTTCACCTTGGCTCATGG + Intronic
1106218614 13:27725453-27725475 CTTCCCTCTTGCCTGGCTGCCGG + Intergenic
1106920593 13:34559113-34559135 TTTCCCATCTCCTCAGCTGCTGG - Intergenic
1107764471 13:43719412-43719434 CTGCCCTTCTGCCTGGTTGCTGG + Intronic
1107862052 13:44670434-44670456 CTTTCCTGCTCCTGGGCTGGTGG - Intergenic
1107993702 13:45840561-45840583 CTTCCCTTCTTCCTGCTTGCTGG - Intronic
1108495257 13:51018566-51018588 TTTCCCTTCTCCTTGGCTTCTGG + Intergenic
1108699748 13:52933594-52933616 CTTCCTTTTTCCTTGGCAGGTGG - Intergenic
1110509614 13:76334025-76334047 CTTCTTTTCTCCATGGCTTCAGG - Intergenic
1111309967 13:86471855-86471877 CTTCTATTCTTCTTGGATGCTGG - Intergenic
1111927341 13:94477774-94477796 CTTCTCTTCTCATAGGATGCTGG - Intronic
1111975739 13:94965548-94965570 CTTTCCTTAACCTTGGCTGCAGG - Intergenic
1112325909 13:98442702-98442724 CTTCCCTGCTCCTCCGCTTCGGG - Intronic
1113545481 13:111145734-111145756 CTTCCCTGCTCTCTGGCTTCTGG - Intronic
1113643784 13:111977382-111977404 CTTTCCTTCTCCAAGTCTGCTGG + Intergenic
1113932144 13:113974198-113974220 CTTCCCTTCTTCTTTCCCGCAGG + Intergenic
1113932158 13:113974245-113974267 CTTCCCTTCTTCTTTCCCGCAGG + Intergenic
1113932172 13:113974292-113974314 CTTCCCTTCTTCTTTCCCGCAGG + Intergenic
1113932186 13:113974339-113974361 CTTCCCTTCTTCTTTCCCGCAGG + Intergenic
1113932200 13:113974386-113974408 CTTCCCTTCTTCTTTCCCGCAGG + Intergenic
1113932214 13:113974433-113974455 CTTCCCTTCTTCTTTCCCGCAGG + Intergenic
1114455268 14:22849722-22849744 CTCCCCTTCTCCAGGGCTCCTGG + Intergenic
1114472339 14:22972514-22972536 TTGCTCTTCTCCTTGGCTGGGGG - Exonic
1114558025 14:23572833-23572855 CTTCCCTGCTCCTTAGGTGCAGG + Intronic
1116845535 14:49861896-49861918 CTTTCGTTCTACTTGGCTACAGG - Intergenic
1118655619 14:67945040-67945062 CTTGCCTTTCCCTTGGCTACAGG - Intronic
1119105920 14:71923771-71923793 CCTCCCTCCTCCCTGGCTCCTGG - Intergenic
1119535333 14:75398408-75398430 CTTCCCTTTTCCTTTTCTGCAGG - Intergenic
1120106365 14:80500056-80500078 CTTCCCTTCTTCCTGGCAGAAGG + Intronic
1121121840 14:91380895-91380917 TTCCCATTCTCCTTGGCTGGTGG - Intronic
1121582932 14:95044531-95044553 CCTCCCTCCTCCTTGGCTGGAGG - Intergenic
1122717049 14:103702148-103702170 CTTGCCTGCTTCTTGGCTACAGG + Intronic
1122986642 14:105214653-105214675 CCCCCTTTCTCTTTGGCTGCCGG - Intronic
1125973172 15:43928716-43928738 CTTCCCTTCCCTTTGCCTGCAGG + Intronic
1126309799 15:47302595-47302617 CTTCCCTTTCCCTTCTCTGCTGG - Intronic
1127735825 15:61838489-61838511 AGTCCCTCCTCCTTGGCAGCTGG + Intergenic
1128748339 15:70130683-70130705 CTTCCCTTCTCCTAGTTGGCAGG - Intergenic
1128981633 15:72192137-72192159 CCTCCCTTCTCCCTGTCTCCTGG - Intronic
1129115666 15:73364099-73364121 CTTCCCTTCCTCATGGCTTCAGG + Intronic
1129219341 15:74122358-74122380 TTTCCCCTCTCCTTGCCTGTAGG - Intronic
1129241926 15:74257025-74257047 CTTCCCCTGCCCTTGCCTGCAGG - Intronic
1129517339 15:76164827-76164849 GCTCCCTTCTCCCTGGCTGGCGG + Intronic
1129605445 15:77022819-77022841 CTTCCTGTCCCCTGGGCTGCAGG - Intronic
1129740131 15:77986062-77986084 GCCCCCTCCTCCTTGGCTGCAGG - Intronic
1129845626 15:78766540-78766562 ACCCCCTCCTCCTTGGCTGCAGG + Exonic
1129906991 15:79195468-79195490 CTTCACTTCTCTGTGGGTGCTGG - Intergenic
1130867229 15:87943316-87943338 CTCACCTTCTCCTGGGCTTCTGG - Intronic
1131193610 15:90337218-90337240 CTGGCTTTCTCCATGGCTGCTGG - Intergenic
1131383117 15:91980884-91980906 CTTCCCTTGGCCTTGGGTCCAGG + Intronic
1131507671 15:93031499-93031521 GTTCCCATCTCCATGCCTGCTGG + Intergenic
1131971808 15:97901035-97901057 CCTACCTTCCCCTTGCCTGCAGG + Intergenic
1131971926 15:97902201-97902223 ATTTCCTTCTCTTTGGCTCCAGG + Intergenic
1132353997 15:101158060-101158082 CTTCCTCTCTCCCTGGCTGGTGG - Intergenic
1132466280 16:78732-78754 CTTCCCTTCTCCTTTGCCCCAGG + Intronic
1133056092 16:3146074-3146096 CTTCCCCTCACCTGGGCTGTAGG - Exonic
1133076278 16:3283371-3283393 CTTCCCTTCTCATTGGTAGGCGG + Exonic
1133267057 16:4591640-4591662 CTTATCTTCCCCTTGGCTGTTGG + Intronic
1133526586 16:6611685-6611707 CTTACCTTGTCCGTGGCTTCTGG + Intronic
1134116611 16:11553477-11553499 CTGCCCTTCTCTCTGGGTGCTGG - Intronic
1134560081 16:15201413-15201435 TCTCCCATCTTCTTGGCTGCAGG - Intergenic
1134920620 16:18113023-18113045 TCTCCCATCTTCTTGGCTGCAGG - Intergenic
1135756839 16:25105771-25105793 CATCCATTCTCCCTGCCTGCTGG + Intergenic
1136287894 16:29254821-29254843 CTCCCCTTCTCCCTGTCTCCCGG + Intergenic
1137926879 16:52548045-52548067 CTTCCCTTCGCCAAGGCTGAAGG - Intergenic
1139084652 16:63570060-63570082 TTTCCATTCTCCAGGGCTGCTGG - Intergenic
1139201965 16:64986956-64986978 CTTCCCTCCTCTTTAGCTACTGG + Intronic
1139228467 16:65256632-65256654 CTTCCCTTCTTGTTGGCTGTAGG + Intergenic
1140969636 16:80000704-80000726 CTTCCCTTCTCCAGTGCTGGTGG - Intergenic
1141553760 16:84823496-84823518 CTGGCCTTCTCCATGGGTGCAGG + Intronic
1141700948 16:85641805-85641827 CTTCCCTACTCACTGGCTGGCGG + Intronic
1142093553 16:88227540-88227562 CTCCCCTTCTCCCTGTCTCCTGG + Intergenic
1142267494 16:89071201-89071223 CATCTCTTCTCCTCTGCTGCTGG + Intergenic
1142497269 17:312872-312894 CTTCCCTCCTCCCTGGCTGCAGG - Intronic
1142698245 17:1645137-1645159 CCTCCCTTCTCCTTGGCTGAGGG + Intronic
1143345424 17:6245464-6245486 CTGCCCTTCCCCTAGGATGCTGG + Intergenic
1143883781 17:10051029-10051051 CTTCCTCTCTGCTTGGCTGAAGG - Intronic
1144206060 17:12980245-12980267 CTTCCCTTCTCCTTGGTCTCAGG + Intronic
1144996115 17:19270323-19270345 CTGCCCTTCTCCTCTGCAGCTGG - Intronic
1146134407 17:30305839-30305861 CTTCCTTTCTCCCTGGCAGGAGG - Intergenic
1146259004 17:31409627-31409649 CCTCCCTGCTCCTTGAGTGCAGG - Intronic
1146490514 17:33278141-33278163 CTCCCCTGCTCCCTGGCTTCAGG + Intronic
1146548926 17:33763468-33763490 TTTCCCTTCTCCTTGGGCACTGG + Intronic
1148512608 17:48185316-48185338 CTTCTCTTCCCCTTCCCTGCTGG + Intronic
1149331491 17:55587379-55587401 CTTCTCCTCTCCATGGCTGCAGG - Intergenic
1149467390 17:56890842-56890864 CTTCCCATAGCCTTGGCTGTGGG - Exonic
1151392640 17:73797935-73797957 CTACCCTTCTCCTTGGGTTGGGG - Intergenic
1151484941 17:74393149-74393171 CTTCCCTCCTCTTTGCCAGCTGG + Intergenic
1151770605 17:76157970-76157992 CTTCCCTTGGTCTTGGCTCCTGG + Intronic
1151904863 17:77041114-77041136 CTTCCCTGCCCCTTGACTTCAGG + Intergenic
1152075667 17:78158264-78158286 CTGCCCTGGTCCTAGGCTGCTGG + Intronic
1152097716 17:78281540-78281562 AGTCCCTTCCCCTGGGCTGCAGG - Intergenic
1152123947 17:78435223-78435245 CTTCCCTTGTCCTTGGGGGCTGG - Intronic
1152579441 17:81159645-81159667 CTTCCCTTCTGCTCTGCTTCTGG - Intronic
1153018078 18:602341-602363 CTTCCCCTCTCCCTGCCTCCAGG + Intronic
1153523983 18:5977846-5977868 CTTACCTCCTCCTGGGCTGAGGG - Intronic
1153821361 18:8834803-8834825 CTTCCCTTCTTGTTGGTGGCTGG - Intergenic
1155314544 18:24558481-24558503 CTCCTCATCTCCTTGCCTGCTGG + Intergenic
1157390360 18:47296978-47297000 CTTACTTTCTCCTTGGCTTGTGG + Intergenic
1157416562 18:47508364-47508386 CTCCCCTTCTACTTGGCAGATGG - Intergenic
1158041017 18:53093749-53093771 TTTATTTTCTCCTTGGCTGCTGG + Intronic
1158253257 18:55514479-55514501 CTTTACTTTTCCTTGGCTGTGGG - Intronic
1159052170 18:63430974-63430996 ATTTCCTTCTCCTTGAGTGCAGG - Intergenic
1159816339 18:73078544-73078566 ACTCCCTTCTCCACGGCTGCTGG + Intergenic
1159994558 18:74951269-74951291 CTTCCCTTCTCATTGCCTTGTGG - Intronic
1160071856 18:75635925-75635947 CTTCCCTCCTCCTCGGTTCCAGG - Intergenic
1160709493 19:544531-544553 CCTCCCTTCTCCCTCACTGCTGG - Intronic
1161255021 19:3303662-3303684 CCTCCCTTCTCATTCACTGCAGG + Intergenic
1161266151 19:3365781-3365803 CTCCCCTGCCCCTTGGGTGCTGG + Intronic
1161327535 19:3670857-3670879 TTTCCCTTCACCGTGGCAGCCGG - Intronic
1161655227 19:5510297-5510319 CTGACCTTCTCCCTGTCTGCGGG - Intergenic
1162030539 19:7915404-7915426 CTGGCCCTCTCCGTGGCTGCAGG - Intergenic
1162797591 19:13094882-13094904 GTTTCTTTCTGCTTGGCTGCTGG - Exonic
1163101328 19:15098856-15098878 TTTTCTTTCTCGTTGGCTGCAGG - Intergenic
1163145038 19:15374144-15374166 TTTTCCTTCTCCGTGGCAGCGGG - Intronic
1166739043 19:45103204-45103226 CTTCCCTTCCTCTAGGCAGCTGG + Intronic
1167033057 19:46976463-46976485 CTCTACTTCTCCTTGGCTGCTGG - Intronic
1167924200 19:52810094-52810116 CTCCCCCTCCTCTTGGCTGCCGG - Intronic
1168540198 19:57203723-57203745 CTGCCCCTCCCCCTGGCTGCTGG + Intronic
925556534 2:5136920-5136942 CTTCTCTGCCCTTTGGCTGCAGG + Intergenic
925699361 2:6618181-6618203 GTTCCCCTCTCCTTGGCTCCTGG + Intergenic
926129292 2:10290832-10290854 CTTCCCCTCTACTTGGTTCCAGG + Intergenic
927261548 2:21096420-21096442 CTTTCCTTCTGCGTGGCAGCTGG + Intergenic
927928068 2:27026787-27026809 CTTCCCTTCCCCATGGCTGGGGG + Exonic
929081982 2:38130125-38130147 GTTCCCTTGGCCATGGCTGCTGG - Intergenic
929940754 2:46332339-46332361 CTTGTTTTCTCTTTGGCTGCTGG + Intronic
930517624 2:52428395-52428417 CCTCCATTCTGCTTGGCTGTGGG + Intergenic
931844870 2:66193229-66193251 CTGCCCTGGTTCTTGGCTGCAGG + Intergenic
932775606 2:74526587-74526609 GTTCCTTATTCCTTGGCTGCGGG - Intergenic
933695795 2:85216234-85216256 CTTTCCTTCCCCGTGGCTCCGGG + Intronic
934084232 2:88496609-88496631 CTTCCCTTCTCCTGGCTTACAGG - Intergenic
934623148 2:95828641-95828663 CTTCTCTCCTCCTTGAGTGCTGG + Intergenic
934978369 2:98822026-98822048 CTTCCCCTTTCCTTGGTCGCTGG + Exonic
935014647 2:99169124-99169146 CTTCTCTGTTACTTGGCTGCGGG - Intronic
935354622 2:102187310-102187332 CTTCCTTTCTCCTTTCCCGCTGG + Intronic
936399666 2:112155805-112155827 CTTGTCTTCTACTTGGCCGCTGG - Intronic
936903820 2:117513913-117513935 CTTCTTTTCTCCTTGACTGTTGG - Intergenic
937326754 2:120994037-120994059 CTTCCCTACTGCATGGGTGCTGG - Intergenic
937336516 2:121065663-121065685 CTTCCCATCCACCTGGCTGCTGG - Intergenic
937440596 2:121912235-121912257 AATCCCTTCTCCTTGGGTGTGGG + Intergenic
937834933 2:126462340-126462362 CTTCCTTTCTCCTGGGCAGCAGG - Intergenic
938208350 2:129442733-129442755 CCTCCCTTCTCCTTGCTTGGTGG + Intergenic
938292911 2:130159817-130159839 CTTCCCCTCCCCTTAGCTGCAGG - Intronic
938463646 2:131513147-131513169 CTTCCCCTCCCCTGAGCTGCAGG + Intergenic
939001257 2:136737993-136738015 CTTTCCTTCTACTTGTCTGTTGG - Intergenic
939342575 2:140917673-140917695 CTTCCCTCCCCCTTAGCTCCTGG - Intronic
940676311 2:156727873-156727895 CCTTCATTCTCCTTGGCAGCTGG + Intergenic
940987752 2:160065165-160065187 CTTCCCTTCTCCTTTGGAGTTGG + Intergenic
943841855 2:192593769-192593791 TTTCCTTTCTCCTTGGTTGCAGG - Intergenic
944660366 2:201916579-201916601 CTTCTCTTCCCCTTGGCAGCAGG - Intergenic
945322454 2:208441004-208441026 CTGCCCTTCTCCTGGCCTGTGGG - Intronic
946045277 2:216815858-216815880 CTTCCCTTCTCCATTGATGAGGG - Intergenic
946201879 2:218075370-218075392 CTTCCCCTGTCCCTGGGTGCTGG - Exonic
946334875 2:219029896-219029918 CTTCCCTGCTCCTAGGAGGCGGG - Intronic
946819601 2:223616415-223616437 CTTCCCATTTCCATGGCTCCTGG - Intergenic
947644399 2:231727725-231727747 TTTCCCTTCTCCTTAGATTCTGG - Intergenic
948103166 2:235391399-235391421 CTCCCCTTCCCATTGGCTTCTGG - Intergenic
948523392 2:238556406-238556428 CTTCTCTGCTCTTTGGCTTCTGG + Intergenic
948527081 2:238577647-238577669 CTTCCCTTCTCCTTGAATCTGGG - Intergenic
949075203 2:242052807-242052829 TTTCCATTCTCCTTGTCTCCTGG - Intergenic
1168775521 20:444180-444202 ATTCCCTTTTCCTAGCCTGCTGG - Intronic
1170301829 20:14892687-14892709 TTTCCCTTCCCCTTAGCTCCTGG + Intronic
1170368991 20:15627771-15627793 CTGCCCTTCTCCTAGCCTGATGG + Intronic
1170718294 20:18851360-18851382 ATTTCCTTTTTCTTGGCTGCTGG - Intergenic
1170821990 20:19762023-19762045 ATTCCTCTCTCCTTGGGTGCTGG + Intergenic
1170829507 20:19827909-19827931 ATACCCTTCTCCTGGGCTGTAGG + Intergenic
1171975961 20:31595026-31595048 CTGCCCTTGCCTTTGGCTGCTGG + Intergenic
1172584929 20:36076626-36076648 CTTCCCTCCTGCTAGGCGGCCGG - Intergenic
1173170227 20:40717534-40717556 CTTCCCTTCTGCCTGCTTGCTGG - Intergenic
1173644787 20:44626590-44626612 CTTCCCTTCCCAGGGGCTGCCGG - Exonic
1174697753 20:52577879-52577901 CTTCCCCTTTCCTTGGCTGTGGG + Intergenic
1174870333 20:54175093-54175115 CTCCCCTCCTCCCTGGCTGGTGG - Intergenic
1175555216 20:59848101-59848123 CTTCCCTCCTCCTTCCCTCCTGG + Intergenic
1175714432 20:61246211-61246233 CTTCCCCTCTCCTTGGTCTCTGG + Intergenic
1176302503 21:5105261-5105283 CTTCCGTGCTTCTTGGCTGGCGG - Intergenic
1179270914 21:39850423-39850445 TTGCCCTTGTCCTTGGCTGCTGG - Intergenic
1179494456 21:41763037-41763059 ATTCCCCTCTCCTTCGCTGCTGG + Intronic
1179854524 21:44156662-44156684 CTTCCGTGCTTCTTGGCTGGCGG + Intergenic
1180918746 22:19507358-19507380 CTTGCATGCTCCTTGACTGCAGG + Intronic
1181660978 22:24348523-24348545 CTGCCCTGCTTCTTGGCTTCTGG + Intronic
1181889770 22:26052257-26052279 ATTCCCTCCAACTTGGCTGCAGG + Intergenic
1182486792 22:30643934-30643956 CTGCCCTTTCCCTGGGCTGCAGG + Intronic
1182930654 22:34171007-34171029 TTTCCTTGCTCCTTGGCTTCTGG + Intergenic
1182949079 22:34354681-34354703 CTCACCCCCTCCTTGGCTGCTGG + Intergenic
1183759093 22:39799349-39799371 CCTCCATTCCCCTGGGCTGCAGG + Intronic
1184176598 22:42792704-42792726 ACCCCCTCCTCCTTGGCTGCAGG + Intergenic
1184287409 22:43479312-43479334 CATCCCTGCTCCCTGCCTGCTGG - Intronic
1184864750 22:47195884-47195906 CTGCCCTCCCCCTGGGCTGCAGG + Intergenic
949576189 3:5341087-5341109 CTCCTATTCTCCTTGTCTGCTGG + Intergenic
950279282 3:11692690-11692712 CTTCCTTCCTCCTTTGGTGCTGG - Intronic
950799157 3:15535320-15535342 CTTCCCTACTCCTGTGCTGGTGG + Intergenic
951782681 3:26381924-26381946 CTTCCCTTCTCCTTGACTCTGGG - Intergenic
953703439 3:45213873-45213895 CTTCCCAACTCTCTGGCTGCTGG + Intergenic
953981675 3:47416393-47416415 CCTCTCTTCTCCTTGGCCGCTGG - Intronic
954410916 3:50370528-50370550 CGTCCCTTCTCTCTGGCTCCTGG - Intronic
955806769 3:62744818-62744840 ATTCCCTGCTCCTTAGATGCAGG + Intronic
955949256 3:64225598-64225620 CTTCCCCTCTCCCTGGCTTGGGG - Intronic
956003090 3:64749791-64749813 CTTCCTGTCTCCTTGGCAGTTGG + Intergenic
956214094 3:66830527-66830549 CTTCACTTCCTCATGGCTGCTGG - Intergenic
956278764 3:67533546-67533568 TTTGCCTTCTCCTTGCCTTCTGG - Intronic
956412772 3:68995559-68995581 CTCCCCTTCTCTGTGGCTGCTGG - Intronic
956570822 3:70692656-70692678 ATTCCCCTCTCCTTGGATGAGGG + Intergenic
956757242 3:72400957-72400979 ATTCTCTTCTCCTTGACTGTGGG + Intronic
957232127 3:77533545-77533567 GTTCCCATTTCCTTGGCTGTTGG + Intronic
959372646 3:105547739-105547761 CTTCCCTTCTCCATGGCCCTGGG - Intronic
959667984 3:108942837-108942859 CTTCCCTCCTCCATGCCTCCAGG + Intronic
959676875 3:109045684-109045706 CTTCCCTTTCTCTTGGCTCCTGG + Intronic
960847919 3:122021971-122021993 CTTCCTGTCTCCTTGGGTCCAGG + Intronic
960942023 3:122941134-122941156 CTTCCCTTCTTCTTGACCCCTGG - Intronic
961354525 3:126327611-126327633 CTCCCCATCTCCTGTGCTGCTGG + Intergenic
961768911 3:129233813-129233835 CTTCTCTTTTCCTCGGCTTCCGG - Intergenic
962232398 3:133676910-133676932 CTTCCCTCCTTCTTGGCTGCTGG + Intergenic
963299869 3:143586004-143586026 CTCCCCTTCCCCTTGGCTTAGGG + Intronic
963545130 3:146647522-146647544 CATCCCAGCACCTTGGCTGCTGG + Intergenic
964460308 3:156917828-156917850 CTTCCCTTCTCCATCACTTCAGG - Intronic
965068720 3:163888282-163888304 CTTCCCTTCTGGTTGTCTGTAGG + Intergenic
965094639 3:164209375-164209397 TTTCACTTCTCTTTGGCTGTAGG - Intergenic
965736918 3:171830228-171830250 CTTTACTTCACCCTGGCTGCAGG - Intergenic
966958795 3:184912176-184912198 TTAGCCTTCTCTTTGGCTGCCGG + Intronic
967806626 3:193719787-193719809 CTTACCTTGGCCTTGGCTCCTGG + Intergenic
968109145 3:196028805-196028827 CTTGCTTTTTCCTTGGTTGCTGG - Intronic
968169599 3:196499304-196499326 GTGCCCTTCTCCTTAGCTTCTGG - Intronic
968287403 3:197517108-197517130 CTGCCTGTCTCCTGGGCTGCTGG + Intronic
968468791 4:767069-767091 CTCCCCTTCCCCTTTGCTGGTGG + Exonic
969609434 4:8218828-8218850 CAGCCCTTCTCCTTGGATGCCGG + Intronic
969692116 4:8709460-8709482 ATTCCCATCTCCTGGGCTGTGGG + Intergenic
971481086 4:27115740-27115762 GCTCCCTTCTCCCTGGCTTCTGG + Intergenic
974386947 4:61213363-61213385 TTTCCATTCTACTTGGGTGCTGG + Intronic
975398651 4:73907686-73907708 CTTGCCTTCTTCTTGGCTCTGGG - Intergenic
978504944 4:109446265-109446287 CTTCACATTTCCTTCGCTGCTGG - Intronic
978969112 4:114780843-114780865 CTTCACTTCTCTGTGGCTCCAGG + Intergenic
981172804 4:141644381-141644403 CTTGACTCCTCCTAGGCTGCTGG + Intronic
981583650 4:146275676-146275698 CTTCCTTTGGCCTTGTCTGCTGG - Intronic
981858578 4:149326341-149326363 TCTCCCATCTCCTTGGCTACAGG + Intergenic
983238575 4:165207193-165207215 CTTCCCATCTCCCTGGGTACAGG + Intronic
984115062 4:175669943-175669965 CCTACCTTCTGGTTGGCTGCTGG - Intronic
984756552 4:183330571-183330593 CTTCCCCTCTGCTGCGCTGCTGG + Intergenic
984850648 4:184149631-184149653 CCTCCCTACTGCTTGGCTGTAGG + Intronic
985580936 5:694718-694740 CTTCCCTCCTGCTCGGGTGCGGG + Intergenic
985595561 5:786050-786072 CTTCCCTCCTGCTCGGGTGCGGG + Intergenic
985755070 5:1708929-1708951 CTTCCCTCCTCCTCCCCTGCGGG - Intergenic
986340616 5:6786241-6786263 CTTCATTGCTCCATGGCTGCAGG - Intergenic
987443357 5:17985013-17985035 CTTCCCTTTTCCATGGCCCCGGG + Intergenic
988533214 5:32043041-32043063 CTTCCCTGCCCTTTGGCTTCTGG + Intronic
993024897 5:82633906-82633928 CCTCCCCACTCCTTGGCTCCTGG - Intergenic
993320629 5:86464651-86464673 GTTCACTTCTCCTGAGCTGCCGG - Intergenic
994185826 5:96814122-96814144 CTTCCCTTCTGCTGGGCCTCAGG - Exonic
994776647 5:104042845-104042867 CTTCCGTTCTCCTTTTATGCAGG + Intergenic
996020811 5:118588980-118589002 TTTCCCTTCTCCTGAGCAGCAGG - Intergenic
996464038 5:123779202-123779224 CTTCTCATCTCCTTGCTTGCAGG + Intergenic
999243142 5:150138941-150138963 CCTCCCTTCTCCTGGCCAGCCGG - Intronic
999243947 5:150143570-150143592 CTTTCCTACTCTTTAGCTGCTGG - Intronic
1000568384 5:162880600-162880622 TCTCCCATGTCCTTGGCTGCAGG - Intergenic
1001272930 5:170329243-170329265 TTTCCCTTTTCCTAGGCTGCAGG + Intergenic
1002318075 5:178357269-178357291 CTTCCCTTCTCACAGGCTTCTGG + Intronic
1002951275 6:1814215-1814237 CTTTCATTCTCCTTAGCTGTAGG + Intronic
1003169917 6:3713003-3713025 TGTCCCTTATCCTTGGGTGCTGG + Intergenic
1003476892 6:6491736-6491758 CTGCCCTTCTCCTGGGCCCCAGG + Intergenic
1003541764 6:7024405-7024427 CATCCCTTCTCCTTGAGTGTGGG - Intergenic
1003853335 6:10247196-10247218 CTATTCTTCTCCTTGGCTTCTGG - Intergenic
1005189540 6:23204583-23204605 CTGCCCTGCTCCTAAGCTGCGGG - Intergenic
1006069455 6:31487673-31487695 GTTCCCTTCTCTGTGCCTGCAGG + Intergenic
1006833425 6:36982775-36982797 CTTGCCTCCTCCCTGGCAGCAGG - Intronic
1007073192 6:39050840-39050862 CTTCCCTGCTCCTGAACTGCTGG - Intronic
1007226826 6:40321040-40321062 CTTCCCTTCTCCCCTGCTGGTGG - Intergenic
1007967789 6:46017976-46017998 CTTTCCTCCTGCTTGGCTTCAGG + Intronic
1009852586 6:69216456-69216478 CTTCCTTTCTCCTGGGCCGATGG - Intronic
1010380373 6:75217139-75217161 ATTCCCTTGTGCTTGGCAGCTGG - Intergenic
1012777512 6:103516525-103516547 CTACCCTTGTCCTGGGCTGCAGG + Intergenic
1014130287 6:117823307-117823329 CTTCCATTCTCCTTCTCTGTGGG + Intergenic
1015843004 6:137493316-137493338 TCTCCCTCCTCCTTGGCAGCCGG + Exonic
1017008716 6:150047269-150047291 CCTCCCTTCTCCTCTCCTGCAGG - Intergenic
1018683909 6:166287096-166287118 GTTCCCTTCTCCTATCCTGCCGG + Intergenic
1019045799 6:169144668-169144690 CTTCCCTTCTCTATGGGTCCAGG + Intergenic
1019667173 7:2257706-2257728 CTTGGCTGCTCCTTGGCTGGGGG - Intronic
1022648999 7:32257923-32257945 ATGCCCATTTCCTTGGCTGCAGG - Intronic
1023556853 7:41432273-41432295 CTTGCCTCCTCATAGGCTGCTGG - Intergenic
1024915388 7:54493181-54493203 CCTCCCTCCTCCTTGGGAGCAGG - Intergenic
1026655241 7:72250956-72250978 TTTCCTTTATCCTTGGCTGTTGG + Intronic
1026949579 7:74338426-74338448 CTTTCCCTCTCCTTCTCTGCAGG + Exonic
1027229293 7:76262953-76262975 CTGCCCTTCCTCTGGGCTGCTGG - Intronic
1029118797 7:98252489-98252511 CACCCCTTCTCCTCGCCTGCAGG - Intronic
1029601054 7:101563682-101563704 CGCCCTGTCTCCTTGGCTGCAGG - Intergenic
1029815041 7:103084946-103084968 CATCCCTGCTACTTAGCTGCAGG - Intronic
1030647765 7:112082454-112082476 CTTCCCTACTCCTTTACTGGGGG + Intronic
1030819729 7:114081784-114081806 CCTAGCTTCTCCTAGGCTGCTGG - Intergenic
1031087288 7:117315260-117315282 TTTTACTTCTCCTTGGCTACAGG + Exonic
1031318767 7:120293366-120293388 CTTCTCTTCTCCTTCCCTTCTGG - Intronic
1035263722 7:157677031-157677053 CAGCCCTCTTCCTTGGCTGCTGG + Intronic
1035421256 7:158730502-158730524 CTTCCTTTCTCCTTGACTGTGGG - Intergenic
1035421264 7:158730541-158730563 CTTCCTTTCTCCTTGACTGTGGG - Intergenic
1035895230 8:3392555-3392577 CTTCCCTCCTGCTTGCCTGTGGG + Intronic
1036127677 8:6078272-6078294 CTTCCCCACTCCCTGGCTACTGG - Intergenic
1036440774 8:8779842-8779864 CTTCCTTTGCCCATGGCTGCTGG - Intergenic
1039798294 8:40933611-40933633 TTTCCCTTCTCCTTGTCTCTCGG - Intergenic
1040377541 8:46841023-46841045 CTTGCCTTCTCTCTGGCTGCAGG + Intergenic
1041099237 8:54379798-54379820 CTTCCCTTCGACTGGGTTGCAGG + Intergenic
1041564549 8:59261943-59261965 CAGCCTTTCTCCTTGGCTCCAGG + Intergenic
1041687916 8:60661127-60661149 CTTCCCTCTTCCTTGGCTGAGGG + Intergenic
1041693057 8:60708528-60708550 CTTCCCTTCACCTGGGATGCAGG + Intronic
1042455544 8:68998327-68998349 CTTCTCTGCTCCTAGGCTGAAGG + Intergenic
1043519604 8:81030089-81030111 CTTTCCTTCTCTTTGGCTATAGG - Exonic
1044535640 8:93353999-93354021 CAGTCCTTCTCCTTGGCTGGTGG + Intergenic
1045063011 8:98424808-98424830 ATTCCCTTGGCCTTGGCTCCTGG - Intronic
1046213227 8:111107276-111107298 TTTTCCTTGTCCTTGGCTCCTGG + Intergenic
1046790194 8:118313454-118313476 CTTCCCTCCTCCTTTCCTGCAGG + Intronic
1047861406 8:128971223-128971245 CTTCCCTCCCCCTTGGATACTGG + Intergenic
1047863715 8:128997858-128997880 CTTCTCATCTCATTGGCTTCTGG + Intergenic
1048056829 8:130874869-130874891 CTTGGCTTCTCCATGGCTGGGGG - Intronic
1048109936 8:131456604-131456626 CTTTCCTTCTAATTGGCAGCAGG - Intergenic
1048614043 8:136055006-136055028 CTCCCCTTCTTCTTGGCAACTGG - Intergenic
1049796482 8:144499497-144499519 CCTCCCTTCCCCTTTGCTCCAGG + Intronic
1051337304 9:16077433-16077455 CTTCCCTACTCCTTGACTTTAGG + Intergenic
1051376187 9:16405087-16405109 CTTCTCTACTCCTTGACTGGAGG + Intergenic
1052864998 9:33459539-33459561 CTTCCCTTCCCCTGGGGTTCTGG + Intergenic
1052989176 9:34508654-34508676 CTGCCCTTCTGCTTGGCTTGAGG - Intronic
1053284629 9:36842267-36842289 CTGCCCTTCACCCTGCCTGCAGG + Intronic
1056223080 9:84468885-84468907 GTTCCCTTCTCCTTGGATCTAGG + Intergenic
1056627893 9:88269164-88269186 GCTCCTGTCTCCTTGGCTGCAGG + Intergenic
1056852013 9:90092978-90093000 CCTCCCTCCTCCTCTGCTGCTGG - Intergenic
1057275737 9:93675198-93675220 CTTCACTTCTGCTTTGCTTCTGG + Intronic
1057554685 9:96078371-96078393 CTGCCCATCACCTGGGCTGCTGG + Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1057842021 9:98494134-98494156 CTTGCCTTTCTCTTGGCTGCTGG - Intronic
1058718535 9:107742874-107742896 CTTTCCTTCTCCTTGGAGCCTGG + Intergenic
1059603590 9:115808774-115808796 CATCCATTTTCCTTGGCAGCAGG - Intergenic
1059657211 9:116367780-116367802 TTTCCCTCCCCCTTAGCTGCAGG - Intronic
1059801187 9:117750963-117750985 CTGACCTTCTCGTTGACTGCTGG - Intergenic
1059915147 9:119091218-119091240 CTGCCCTCCTCCTTGGCTGGAGG - Intergenic
1060370911 9:123070125-123070147 CTTCCCTACTCCTTCGCCACAGG + Intronic
1060881681 9:127122317-127122339 CTTCCCTCCTGCTTGGCTCCGGG + Exonic
1061359693 9:130133128-130133150 CATCTCTTCTCCTGGGCTGTGGG + Intronic
1061489559 9:130937741-130937763 CTCCCCTCCGCCTTGGCTTCGGG + Intronic
1061616688 9:131784935-131784957 TTTCCCTTCCCCAGGGCTGCCGG - Intergenic
1061620829 9:131810306-131810328 CATCCCGGCTCCTTGGCTGCAGG - Intergenic
1062098954 9:134718052-134718074 TTTCCCGTCTCCATGGCTCCAGG + Intronic
1062237397 9:135516906-135516928 CTCCCTTTCTCCTGAGCTGCAGG + Intergenic
1062424572 9:136500181-136500203 CCTCCCTCAACCTTGGCTGCCGG - Intronic
1185612000 X:1398520-1398542 CCCCCCTTCGTCTTGGCTGCTGG - Intergenic
1185975031 X:4710716-4710738 CTTCCCTTATCTCTGCCTGCAGG - Intergenic
1187358537 X:18602056-18602078 CTTCCCTGCTCCTTCCCTGCAGG - Intronic
1188899384 X:35711151-35711173 TTTCCCCTCTTCTTGGCTGCTGG - Intergenic
1189633248 X:42976939-42976961 CTTCCCTTATCTGTGCCTGCAGG + Intergenic
1191131840 X:57022254-57022276 CTTCCCTCCTCCTTGCCTACAGG + Intergenic
1194284553 X:91993798-91993820 CTTCCCTTCTCCTTGGCTGCAGG + Intronic
1194590687 X:95796777-95796799 CTTGCCATCTGCTTGGCTTCTGG - Intergenic
1196442895 X:115730968-115730990 CTTGCCTTCACCTTGGCTTGGGG + Intergenic
1196493620 X:116297530-116297552 CTTCCTTTCTCCTTACCTTCTGG + Intergenic
1196734357 X:118971823-118971845 CTTCTCTTCTCCATGCCTGCAGG + Intergenic
1197109050 X:122750509-122750531 TTTCCCTTTCCCTTGGCTACAGG + Intergenic
1198691184 X:139286503-139286525 CTTCCCTTTCCACTGGCTGCTGG + Intergenic
1199480717 X:148295965-148295987 CCTTCCCTCTCCTTGGCTTCTGG - Intergenic
1199772435 X:150983550-150983572 CTTCCCTCCTGCTAGGCGGCCGG + Intronic
1200138055 X:153884595-153884617 CTTCCCACCTCCTTGGCTCCTGG - Intronic
1200255558 X:154580694-154580716 CTTCCCTCCTCCCCGCCTGCAGG + Intergenic
1200262211 X:154623710-154623732 CTTCCCTCCTCCCCGCCTGCAGG - Intergenic
1200602120 Y:5218362-5218384 CTTCCGTTCCCCTTGGCTGCAGG + Intronic
1200859000 Y:7970081-7970103 CTTGCCTTCTCTCTGGCTACAGG - Intergenic
1201351153 Y:13042581-13042603 CCTACTTTCTCCTTGGCTCCAGG - Intergenic
1201480830 Y:14437830-14437852 GTTCCCTTATCTGTGGCTGCAGG - Intergenic