ID: 1194284596

View in Genome Browser
Species Human (GRCh38)
Location X:91994474-91994496
Sequence CAGGATCTCCTTGTTTTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5739
Summary {0: 3, 1: 7, 2: 157, 3: 1134, 4: 4438}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194284592_1194284596 8 Left 1194284592 X:91994443-91994465 CCTCCGTGTTCATCAATGTTGTC 0: 1
1: 1
2: 28
3: 336
4: 1226
Right 1194284596 X:91994474-91994496 CAGGATCTCCTTGTTTTTAAGGG 0: 3
1: 7
2: 157
3: 1134
4: 4438
1194284593_1194284596 5 Left 1194284593 X:91994446-91994468 CCGTGTTCATCAATGTTGTCACA 0: 2
1: 11
2: 276
3: 701
4: 1508
Right 1194284596 X:91994474-91994496 CAGGATCTCCTTGTTTTTAAGGG 0: 3
1: 7
2: 157
3: 1134
4: 4438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194284596 Original CRISPR CAGGATCTCCTTGTTTTTAA GGG Intronic
Too many off-targets to display for this crispr