ID: 1194285600

View in Genome Browser
Species Human (GRCh38)
Location X:92007118-92007140
Sequence ACCAGGGCCTTGAGCAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 5, 2: 7, 3: 26, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194285600_1194285603 -3 Left 1194285600 X:92007118-92007140 CCATGTTTGCTCAAGGCCCTGGT 0: 1
1: 5
2: 7
3: 26
4: 265
Right 1194285603 X:92007138-92007160 GGTGCTCTACAATCAGCATGTGG 0: 2
1: 11
2: 71
3: 236
4: 515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194285600 Original CRISPR ACCAGGGCCTTGAGCAAACA TGG (reversed) Intronic
900163760 1:1236622-1236644 AGCAGGGCCTTGCGCGAACAAGG - Intergenic
900327055 1:2113546-2113568 ACCAGGGCCTTGAGTGAGCTGGG + Intronic
900372860 1:2339990-2340012 ACCTGCGTCTTCAGCAAACACGG - Intronic
900572988 1:3368565-3368587 AGGAGGGCCTTGTGCAAAGATGG - Intronic
901496338 1:9624499-9624521 ACCGGGTCCTTGAGCAGACTGGG - Intergenic
902050353 1:13559450-13559472 ACCAGGGACTTGAGGATCCAAGG + Intergenic
903066818 1:20704297-20704319 ACCAGGGCCCTGCGCTCACATGG + Intronic
903308608 1:22433590-22433612 ATCAGGGACTTGAGCATCCATGG + Intergenic
903355311 1:22742837-22742859 ACAAGGACCCTGAGCAAACCTGG - Intronic
904295071 1:29514836-29514858 ATGAGGACCTTGAGCAGACATGG - Intergenic
904363367 1:29993053-29993075 CCCAGGGCCTTGGGCAGTCAGGG - Intergenic
906670426 1:47650344-47650366 ACCAGGCCCTGGAGCACACTTGG + Intergenic
907221378 1:52909342-52909364 ACAAGGGGCTTGAGCATCCATGG - Intronic
908160082 1:61398292-61398314 GTCAGGGCCTTGAGCAACAAAGG + Intronic
908659509 1:66421863-66421885 GCCAGGGCCTTCAGCAAGGAAGG - Intergenic
910629583 1:89341474-89341496 ACCAGGGCATTGGGCAAAGCAGG + Intergenic
911139734 1:94486255-94486277 ATCAGGGACTTGAGCATCCATGG + Intronic
912247712 1:107978218-107978240 ACCTGGGCCTTCAGCAAGGAAGG + Intergenic
912692990 1:111818679-111818701 CCCAGGGCATGGAGCAAAGAAGG - Intronic
917023678 1:170617285-170617307 TCCACGGTCTTGAGAAAACATGG - Intergenic
919279356 1:195467376-195467398 ATCAGGGACTTGAGCATATATGG - Intergenic
919325409 1:196100453-196100475 CTCAGGACCTTAAGCAAACATGG + Intergenic
920861687 1:209713617-209713639 ACAAGGGACTTGAGCATCCATGG - Intronic
921519699 1:216144925-216144947 ACCAGGACTTTGAGCAAAATAGG + Intronic
922908881 1:229198894-229198916 AACAGGGACTTGAGCATCCATGG + Intergenic
1063108228 10:3012413-3012435 ACCTGGGGCTTGCTCAAACACGG - Intergenic
1066708329 10:38204482-38204504 CCCAGGGCCTTGAGCAAAATAGG + Intergenic
1068059565 10:52050266-52050288 ACTATGGCATTGAGCAGACATGG + Intronic
1069832686 10:71290855-71290877 ACCAGGCCCTGGGGCAATCAGGG - Intronic
1070673116 10:78392163-78392185 ACCAGGGACTTGAGCATCCCTGG + Intergenic
1074189600 10:111124340-111124362 AGCAGGGCCTGGAGCTGACAGGG - Intergenic
1074238957 10:111617259-111617281 CCCAGGGCCTGGCACAAACAAGG + Intergenic
1074831471 10:117252643-117252665 ACCAGTGCCTAGAGCATAGAAGG - Intronic
1075059567 10:119246173-119246195 ATCAGGGACTTGAGCATCCATGG - Intronic
1075063098 10:119270517-119270539 ATCAGGGACTTGAGCATCCATGG + Intronic
1075408127 10:122208045-122208067 ACTAGGGCCTAGAGGAAACAGGG + Intronic
1075496469 10:122923422-122923444 CCTAGGGTCTTGAGCAAACATGG + Intergenic
1076078247 10:127554781-127554803 ACCAGGCCCATGAGCAGACGAGG - Intergenic
1079258395 11:18852867-18852889 ACCTGGGCATGGAGCAAAGAGGG - Intergenic
1079479465 11:20864505-20864527 CCCAGGGCCTTGATCAAAGAGGG + Intronic
1079675090 11:23217158-23217180 ACCTGGGCCTTGGGAAAACAAGG - Intergenic
1081644408 11:44779556-44779578 ACCATGGCCTTGTGAAGACATGG + Intronic
1083028738 11:59572802-59572824 ATGAGGGCCTTGATCAATCAAGG + Intergenic
1083110528 11:60401778-60401800 AATAGAGCCTTGAGAAAACAAGG + Intronic
1083257243 11:61504176-61504198 ACCATGGCATTGAGCAAAGATGG - Intergenic
1084319898 11:68367414-68367436 ACCAGGGCCTTGCTCCACCAGGG - Intronic
1084406724 11:68978577-68978599 CCCAGGGCAATGAACAAACAGGG + Intergenic
1084754059 11:71223591-71223613 ATCAGGGACTTGAGCATCCATGG + Intronic
1085522550 11:77146878-77146900 CCCAGGGCCCTGAGGAAACCAGG + Intronic
1086411953 11:86552492-86552514 ACCAGGGTCCTGAGATAACAAGG - Intronic
1088839502 11:113612183-113612205 ACCAGGGCTCTGAGGAAAAATGG + Intergenic
1088938130 11:114425456-114425478 CCTAGAGCCTTGAGAAAACATGG - Intronic
1090110531 11:123903236-123903258 ATCAGGGACTTGAGCATTCAGGG + Intergenic
1091535949 12:1409630-1409652 ATAAGGGACTTGAGCAACCATGG - Intronic
1092476995 12:8828114-8828136 CCTAGGGCCTTGAGCAAACATGG - Intronic
1092893339 12:12989969-12989991 ATCAGGGACTTGAGCATCCATGG - Intronic
1094285908 12:28793375-28793397 ACCAGAGACTTGAGCAAAGCTGG + Intergenic
1094711660 12:32969852-32969874 ATCAGGGCCTCGAGCATCCATGG - Intergenic
1094846758 12:34364726-34364748 CCCCGGGCCTTGTGCAAGCACGG + Intergenic
1095951672 12:47785063-47785085 ACCAGGCCTTTTGGCAAACAAGG + Intronic
1098230757 12:68370017-68370039 TCCGGGCCCTTGAGCAAACCTGG - Intergenic
1100342772 12:93696928-93696950 ATCAGGGACTTGAGCATCCATGG + Intronic
1100452426 12:94720320-94720342 CCCAGGACCTTGAGCAGCCAAGG + Intergenic
1101226762 12:102695021-102695043 CCCAGGGCCTTGAGAAAACATGG + Intergenic
1101366877 12:104080289-104080311 ATCAGGGACTTGAGCATCCATGG - Intronic
1102940303 12:116935530-116935552 ACTTGGGTCTTGAGCATACAAGG - Intronic
1103704831 12:122865854-122865876 CCCTGGGCCTTCAGCACACATGG + Exonic
1104458274 12:128933156-128933178 AACAGGGCTTTTAGGAAACAGGG - Intronic
1104971942 12:132534738-132534760 GCCTGGGCCTTGAGCCACCAAGG - Intronic
1106232817 13:27834441-27834463 AGCAGGGACTTGAGCATCCATGG - Intergenic
1106740251 13:32633142-32633164 ACCAGGGGCTGGGGAAAACAGGG + Intronic
1106922036 13:34574215-34574237 ACCAGGGGCTTGATCATCCATGG + Intergenic
1107147954 13:37079820-37079842 ACAAGGGACTTGAGCATCCATGG + Intergenic
1107710870 13:43149347-43149369 ATCAGGGACTTGAGCATCCATGG - Intergenic
1108951834 13:56104158-56104180 ATCAGGGACTTGAGCATCCATGG - Intergenic
1109242022 13:59901261-59901283 ACCAGGGCCTTGATCATGCATGG - Intronic
1109785979 13:67175437-67175459 AGCAGGGCCTGGAACAAACAGGG + Intronic
1111579858 13:90208554-90208576 ATCAGAGCCTTGATGAAACATGG - Intergenic
1111996250 13:95168684-95168706 ACCAGGGCCTGGAACAGAGAAGG + Intronic
1113675985 13:112208329-112208351 ACAAGGGCCTTGGGCATCCATGG - Intergenic
1114064268 14:19047555-19047577 ACCTGGGCCTTGAGGAATCCTGG - Intergenic
1114097991 14:19352443-19352465 ACCTGGGCCTTGAGGAATCCTGG + Intergenic
1114675759 14:24439289-24439311 ACCAGGGCCCTTAGCACAAAAGG - Exonic
1114889999 14:26908098-26908120 ATCAGGGACTTGAGCATTCATGG - Intergenic
1118035112 14:61858240-61858262 ATCAGGGCCTTCCGCATACAGGG + Intergenic
1120437319 14:84497062-84497084 GCAAGGGCCTTGAGCGTACAGGG - Intergenic
1122219753 14:100229972-100229994 AGCTGGGCTTTAAGCAAACATGG - Intergenic
1122585987 14:102807020-102807042 ACCAGGGACGTGGGAAAACAGGG - Intronic
1124214848 15:27797826-27797848 TCCAGGCCCTTCAGGAAACATGG - Intronic
1124579001 15:30935603-30935625 ATCAGGGACTTGAGCATCCATGG + Intronic
1126163499 15:45634874-45634896 ACCAGGGCGTTGAGCGCTCACGG - Exonic
1126351968 15:47753165-47753187 ATCAGGGCCTTGAGGAAAGTGGG + Intronic
1127318848 15:57823023-57823045 ATCAGGGACTTGAGCATCCATGG + Intergenic
1128720170 15:69942158-69942180 ACCACGGCCTTGAGACCACATGG - Intergenic
1129335921 15:74852179-74852201 ACCACGGCCTGGAGAGAACAGGG + Exonic
1130061150 15:80570975-80570997 ACCAGGGCCATCAGCACAGACGG + Intronic
1131164447 15:90132171-90132193 ATCAGGGACTTGAGCATGCATGG - Intergenic
1131317293 15:91350987-91351009 ATCAGGGACTTGAGCATCCATGG - Intergenic
1132031328 15:98440475-98440497 ACCAGACTCTTGACCAAACAGGG - Intronic
1132572532 16:650219-650241 AGCAGGGCCGTGAGGAGACAGGG - Intronic
1132750427 16:1455062-1455084 ACCTGGGCCTTAAGCAAACAGGG + Intronic
1134630213 16:15750760-15750782 CCCAGGGCCTGGAGCACAGAAGG - Intronic
1137030224 16:35517045-35517067 AACAGGGACTTGAACAAAGAAGG + Intergenic
1137923904 16:52521367-52521389 GCCAGGGACATGAGCAAACATGG - Intronic
1138889244 16:61122083-61122105 ACCGGGGCTTTGAGAAAAAATGG + Intergenic
1142288173 16:89179954-89179976 ACCAGGGCCCTGAGGACACCAGG + Intronic
1142357357 16:89608070-89608092 ATCAGGGACTTGAGCATCCATGG - Intergenic
1142366435 16:89652422-89652444 ACCAGCACCTCGAGGAAACAGGG + Intronic
1142366456 16:89652499-89652521 ACCAGCACCTCGAGGAAACAGGG + Intronic
1142366477 16:89652576-89652598 ACCAGCACCTCGAGGAAACAGGG + Intronic
1143882703 17:10041949-10041971 ACAAGGGCCTACAGCAAATAAGG - Intronic
1145104025 17:20099924-20099946 ATCAGGGACTTGAGCATCCATGG - Intronic
1145859283 17:28193925-28193947 TCCTGGGCCTTGGGGAAACAAGG + Intronic
1149075633 17:52594348-52594370 CCCTGGGCCTTGAGTGAACATGG - Intergenic
1149567394 17:57649854-57649876 ACCAGGGCCTTGCCAAAACCTGG - Intronic
1150117956 17:62571223-62571245 ATCAGGGACTTGAGCATCCATGG - Intronic
1150626710 17:66846386-66846408 GCCAGGGCCTTGGGAAAAGAGGG - Intronic
1151781426 17:76248780-76248802 ATCAGGGACTTGAGCATCCAAGG - Intergenic
1153099700 18:1452245-1452267 CCCAGGGCCTGGAGTGAACATGG + Intergenic
1153567333 18:6431403-6431425 ACCAGAGCCTGTAGTAAACATGG - Intergenic
1154000848 18:10481225-10481247 AGCAAGGACTTGAACAAACATGG + Intronic
1154115715 18:11611577-11611599 ATCAGGGACTTGAGCATCCATGG + Intergenic
1154120159 18:11645796-11645818 ATCAGGGACTTGAGCATCCATGG + Intergenic
1156392389 18:36662859-36662881 ACCAGGGGATTGAGGAAAGAGGG - Intronic
1156479608 18:37427678-37427700 CCCAGGGCCTTGAGCAGGAAGGG - Intronic
1156640949 18:39098080-39098102 AACAAGGCCTTCAGCAGACATGG - Intergenic
1156913228 18:42436098-42436120 ACCAGTGCATTTAGCAAATATGG + Intergenic
1157061200 18:44292740-44292762 ACATGGGCCTTGAGCAACAAAGG + Intergenic
1157311130 18:46554118-46554140 AGGAGGGCCTTGGGCAAGCATGG + Intronic
1157956127 18:52099574-52099596 ACCAGGTCATTTAGCAAACTGGG - Intergenic
1158614590 18:58974952-58974974 AACAGGGCCTCTAGCAAAAATGG - Intronic
1158891801 18:61879396-61879418 ATCAGGGACTTGAGCATGCATGG + Intronic
1160186324 18:76679226-76679248 ACCAGGAGCTGGAGGAAACAGGG + Intergenic
1161204302 19:3032861-3032883 GCCTGGACCTTGAGCATACATGG + Intronic
1162924203 19:13921719-13921741 GACATGGCCTTGAGCAAAAAAGG + Intronic
1163128857 19:15259450-15259472 GCCAGGGCCATGAGCACCCAGGG - Intronic
1164813545 19:31176893-31176915 ACAAGAACCTGGAGCAAACAGGG + Intergenic
1165847370 19:38826999-38827021 ACCAGGGCCCTCAGCAAGGATGG + Intronic
1167439446 19:49499963-49499985 ACCAGGGCCTGGAGGACCCAGGG - Intergenic
1167442418 19:49516058-49516080 CTCTGGGCCTTGAGCAAAGAGGG + Intronic
1168605795 19:57759097-57759119 CCTAGGGCCTTGAACAAACAGGG + Intergenic
925379438 2:3415011-3415033 ACCAAGGACTTGAGCAGTCATGG + Intronic
926655724 2:15403614-15403636 ATCAGGGACTTGAGCATCCATGG + Intronic
927522824 2:23710846-23710868 ATCAGGGACTTGAGCATCCAGGG + Intergenic
929611457 2:43273804-43273826 CCCCGACCCTTGAGCAAACAGGG - Intronic
930004595 2:46886286-46886308 ATCAGGGACTTGAGCATCCATGG + Intergenic
931069989 2:58635704-58635726 GCCATGGCCTTTAGCATACAGGG + Intergenic
931343685 2:61426694-61426716 ACCAGGGCCTTCAGCAAACATGG + Intronic
931972701 2:67607057-67607079 AGCAGGGCTTTGAGCAAAAAAGG - Intergenic
932465399 2:71920372-71920394 ATCAGGGACTTGAGCATCCATGG + Intergenic
934616305 2:95773309-95773331 AAGAGGGTCTTAAGCAAACACGG - Intergenic
934838005 2:97607341-97607363 AAGAGGGTCTTAAGCAAACACGG + Intergenic
935262439 2:101366982-101367004 ATCAGGGACTTGAGCATCCACGG + Intronic
935819382 2:106878743-106878765 ATCAGGGACTTGAGCATCCATGG + Intronic
936404770 2:112193121-112193143 ATCAGGGACTTGAGCATCCATGG - Intergenic
938288269 2:130136285-130136307 ACCAGGCCCTGGAGCACACTGGG - Intergenic
941391394 2:164919602-164919624 ATCAGGGACTTGAGCATCCATGG - Intronic
945637876 2:212380400-212380422 ACCAGGGACTTGAGTATCCATGG + Intronic
946064116 2:216971722-216971744 TCAAAGGCCTTGAGAAAACAGGG + Intergenic
946439278 2:219681384-219681406 ACCAGGGCCTTGAGCAAGCAGGG + Intergenic
947276894 2:228401841-228401863 ACCAGGGCCAAGAGAGAACAAGG - Intergenic
947453174 2:230227035-230227057 ATCAGGGACTTGAGCATCCATGG + Intronic
948657717 2:239487008-239487030 CCCAGGGCCGTGAACAGACATGG + Intergenic
1168954008 20:1821509-1821531 AACAGGGCCTAGAACAAACCAGG + Intergenic
1169008934 20:2233681-2233703 ACAAGGGACTTGAGCATCCATGG + Intergenic
1171198790 20:23224576-23224598 ACAAGGGACTTGAGCATCCATGG - Intergenic
1173433974 20:43016222-43016244 CCCAGGGTCTGGAGGAAACATGG - Intronic
1175222681 20:57426399-57426421 ACCAGGCCCCTTAGCACACACGG + Intergenic
1179064172 21:38008645-38008667 GCCAGGGCCTTGAGGAAGTAGGG + Intronic
1180482759 22:15770181-15770203 ACCTGGGCCTTGAGGAATCCTGG - Intergenic
1182416476 22:30224514-30224536 ACCAGGGACATGAGCACACCCGG + Intergenic
1182455958 22:30450726-30450748 ACCCAGGCCTTGAGCCAGCAGGG - Intronic
1182748295 22:32622458-32622480 ACCTGGGTCTTGAGGAAACTGGG + Intronic
1183524390 22:38315000-38315022 ACCAGGGACTGCAGTAAACAGGG + Intronic
1184353862 22:43964944-43964966 GCCAGGGCCCTGAGGAGACAGGG - Intronic
1184524732 22:45015127-45015149 ATCAGGGACTTGAGCATCCATGG - Intergenic
1184645501 22:45892610-45892632 CCCAGGGCCTTGAGCACATGAGG - Intergenic
949513692 3:4788452-4788474 CCCAGGCCCTTGAGCTCACAGGG + Intronic
949702974 3:6780557-6780579 ACCAGGCCCTAGTGCAAAGAGGG - Intronic
951326842 3:21313185-21313207 ACCAGGGCCTTGAGGGTAAAAGG + Intergenic
952673100 3:35994469-35994491 CTCAGGGCCTTGAGTGAACATGG + Intergenic
952823718 3:37507153-37507175 ACCAGGGCCCTGAGCTGGCAGGG + Intronic
952911332 3:38190125-38190147 AACAGGGCCCTGATCACACATGG + Intronic
953340727 3:42132126-42132148 ATCAGGGACTTGAGCATCCATGG - Intronic
953449726 3:42996102-42996124 ACCAGGGCAACCAGCAAACAGGG + Intronic
953571544 3:44075640-44075662 GCCAGGGGCTTGTGCAAACTGGG + Intergenic
954477719 3:50764484-50764506 ATCAGGGACTTGAGCATCCATGG + Intronic
954851037 3:53600845-53600867 ACCAAGTCCTTCAGCGAACAGGG - Intronic
956278521 3:67529930-67529952 AATGGGGCCTTTAGCAAACAGGG + Intronic
957915913 3:86687450-86687472 CCCAGGGCCTTCAGCAAACATGG + Intergenic
958078448 3:88713331-88713353 CCCAGGGCTTTGAGAGAACAGGG + Intergenic
958123575 3:89326201-89326223 ACAAGGGACTTGAGCATCCATGG - Intronic
959152825 3:102628512-102628534 ACCAGGGACTTGAGCATCCTTGG + Intergenic
960595943 3:119408154-119408176 ATCAGGGACTTGAGCACACATGG + Intronic
961263682 3:125622931-125622953 ATCAGCGACTTGAGCAATCATGG - Intergenic
961501813 3:127341526-127341548 ATCAGGGACTTGAGCATCCACGG - Intergenic
965457080 3:168914897-168914919 ACCAGGTCCTAGAGAAACCAAGG - Intergenic
966401031 3:179546959-179546981 CCTGGGGCCTTGAGCAAACAGGG + Intergenic
966898406 3:184462958-184462980 ATCAGGGACTTGAGCATCCATGG + Intronic
969388644 4:6874270-6874292 AACAGGGACTTGAGGAAATAGGG + Intronic
969897441 4:10318498-10318520 GCCTGGGCCTAGAGCAAACTTGG + Intergenic
970586404 4:17518411-17518433 ACCAGGCTCTTAAGAAAACAGGG + Intronic
970965238 4:21920696-21920718 ATCAGGGACTTGAGCATCCATGG + Intronic
971758652 4:30735635-30735657 ATTAGGGCCTTGAGGAAAGATGG + Intronic
971949985 4:33332439-33332461 ACCTGGGCATGGAGCCAACAGGG - Intergenic
974295235 4:59989436-59989458 ACCAGGGCCTTGAATAACAATGG - Intergenic
976171628 4:82310724-82310746 TCTAGGGCTTTGAGCAAACATGG - Intergenic
976559797 4:86488383-86488405 ACAAGGGGCTTGAGGAAACCAGG - Intronic
977672252 4:99709379-99709401 ACCAGGGGCCTGAGCAAGGAAGG - Intergenic
979676813 4:123418647-123418669 GCAAGGGCCAGGAGCAAACAGGG - Intergenic
979915236 4:126423602-126423624 ATCAGGGACTTGAGCATTCATGG - Intergenic
982558457 4:156899326-156899348 AGCAGGGACTTGAGCAACCTTGG + Intronic
984002917 4:174272269-174272291 ACAAGGGACTTGAGCATTCATGG - Intronic
985296402 4:188441847-188441869 ATCAGGGTCTTGAGCATCCACGG + Intergenic
986058575 5:4164291-4164313 CCAAGGGCCTTGAGTAAAGATGG + Intergenic
986088829 5:4481459-4481481 CCCAGGGGCTTGAGCAACCGTGG + Intergenic
986795798 5:11210827-11210849 CCCAGCACCTTGAGCAGACAAGG - Intronic
988341830 5:29982479-29982501 ACCAAGGCCTTGGGCACACCAGG - Intergenic
988791000 5:34607531-34607553 ATCAGGGACTTGAGCATCCATGG + Intergenic
989173118 5:38493152-38493174 ACCTGGACCCTGGGCAAACAAGG + Intronic
989242182 5:39214410-39214432 AGCAGGGACTTGAGCAGATATGG + Intronic
990402107 5:55448832-55448854 ATCAGGGACTTGAGCATCCATGG - Intronic
990845562 5:60134598-60134620 ATCAGGGGCTTGAGCATCCATGG - Intronic
992313559 5:75528950-75528972 ATCAGGGACTTGAGCAATCGTGG - Intronic
992587257 5:78252864-78252886 CCCAGGGCCTTGAGCAAACATGG + Intronic
995708374 5:115009342-115009364 ATCAGGGACTTGAGCATCCATGG - Intergenic
996949359 5:129107677-129107699 ATCAGGGACTTGAGCATCCATGG + Intronic
999315209 5:150579182-150579204 CCCAGGCCCCTGAGCACACAGGG - Intergenic
999371470 5:151057903-151057925 ATCAGGGACTTGAGCATCCATGG + Intronic
999591141 5:153148055-153148077 GCCAGGGCATGGAGCAAAGAGGG - Intergenic
1000635984 5:163644190-163644212 ATAAGGGCCTTGAGCATCCATGG - Intergenic
1000807374 5:165812564-165812586 ACCTGGGCCCTGAAAAAACATGG - Intergenic
1001058047 5:168465396-168465418 ACCAGGGCCTTCTGCTAACAAGG + Intronic
1001702335 5:173716178-173716200 CCCAGAGGTTTGAGCAAACATGG - Intergenic
1001894611 5:175367526-175367548 TCCAGGGCCTTCTGCAAAGAAGG - Intergenic
1002883340 6:1272281-1272303 ATCAGGGACTTGAGCATCCATGG + Intergenic
1010521037 6:76837765-76837787 ACCAGCGCCTTGAGCCTCCAAGG - Intergenic
1012086780 6:94836730-94836752 ACCAGGGACTTGAGCATTCATGG - Intergenic
1013023600 6:106245959-106245981 ACCATGGCCTTGACCAAAGGAGG - Intronic
1013137710 6:107298493-107298515 ATCAGGGACTTGAGCATCCAAGG + Intronic
1014459529 6:121679526-121679548 ATCAGGGACTTGAGCATCCATGG + Intergenic
1015304627 6:131694275-131694297 AACAGGGCCTGGTGCATACATGG - Intronic
1016251653 6:142049675-142049697 CCCAGGGCTTTGAGTAAACATGG + Intergenic
1016848356 6:148591636-148591658 ATCAGGGACTTGAGCATCCAGGG + Intergenic
1018081592 6:160263517-160263539 ACCAGGGCCTTCAGAAGAGAAGG - Intronic
1018611212 6:165649437-165649459 ACCAGGGCGGAGGGCAAACACGG + Intronic
1021130909 7:16912662-16912684 CCCAGGACCTTGAACAAACCTGG - Intergenic
1022122473 7:27322953-27322975 ATCAGGGACTTGAGCATCCATGG + Intergenic
1023253271 7:38287863-38287885 ATCAGGGACTTGAGCATACATGG - Intergenic
1023715497 7:43039618-43039640 GCCTGGGCAATGAGCAAACAGGG - Intergenic
1023780289 7:43648788-43648810 ACCAGGGCCTTTCACAGACAAGG - Exonic
1024567303 7:50692218-50692240 ATCAGGGCCTTGAGCATCCTTGG + Intronic
1026369059 7:69680606-69680628 ACCAGGGGCTGGAGGGAACAAGG - Intronic
1027449507 7:78314600-78314622 ACCAGGGGCATGTGCACACATGG + Intronic
1030198142 7:106873631-106873653 ATCAGGGGCTTGAGCATTCATGG + Intronic
1030316073 7:108115792-108115814 ATCAGGGACTTGAGCATCCATGG + Intronic
1031741926 7:125443404-125443426 ATCAGGGACTTGAGCATCCATGG - Intergenic
1038392118 8:27211662-27211684 ACCAGGGACTTGAGCATCCTTGG + Intergenic
1040511416 8:48099706-48099728 CCCAGGGCCTTGAGAAAGCATGG - Intergenic
1040530986 8:48266055-48266077 CCCAGGGCCTGGAGCAGTCAAGG + Intergenic
1041103560 8:54420050-54420072 ATCAGGGACTTGAGCATCCATGG + Intergenic
1041146195 8:54878756-54878778 ACCAGGGGCTACAGGAAACAGGG - Intergenic
1041418145 8:57636487-57636509 AACAGGACTTTGAGCAAATATGG + Intergenic
1041437639 8:57860183-57860205 AATAGGGCCCTGAGCAAAAATGG + Intergenic
1041616128 8:59908131-59908153 CCTAGGGCCTTAAGCAAACATGG + Intergenic
1041820689 8:62029456-62029478 AATAGGGCCTTCAGCACACAAGG + Intergenic
1042895763 8:73665790-73665812 ATCAGGGGCTTGAGCAGCCATGG - Intronic
1043385203 8:79741741-79741763 GCCAGGGCCTTCAACAAAGAAGG - Intergenic
1044246253 8:89950257-89950279 ATCAGGGACTTGAGCATCCATGG - Intronic
1045269933 8:100652952-100652974 AAAAGGGTCTTGAGCAAACATGG + Intronic
1045590045 8:103582923-103582945 CCCAGGACCTTGAGCAAAATAGG + Intronic
1046838002 8:118824648-118824670 ACCAGGGCCATGCACACACAGGG + Intergenic
1047318449 8:123755458-123755480 ACCAGGCCCCTGAGAAAGCAGGG + Intergenic
1047350973 8:124073338-124073360 AGGAGGGACTTGAACAAACAGGG + Intronic
1048506245 8:135024845-135024867 ATCAGGCCCATGAGGAAACATGG - Intergenic
1048856673 8:138692666-138692688 AACAAGGCCTGGAGGAAACATGG - Intronic
1050033794 9:1413914-1413936 ACCAAGGCCCTGAGCAACCAAGG + Intergenic
1050341238 9:4641322-4641344 ATCAGGGACTTGAGCATTCATGG - Intronic
1050643663 9:7695304-7695326 ACCACAGCCTTGAGTAAGCATGG - Intergenic
1051675503 9:19554443-19554465 ATCAGGGACTTGAGCATCCATGG + Intronic
1051992166 9:23164060-23164082 CCTAGGGCCTTGAGTGAACATGG + Intergenic
1052063407 9:23987606-23987628 CCCAGGGCCTTGAGCAAACATGG + Intergenic
1053432444 9:38051980-38052002 ACCAGGGCTCTGAGCCAACGCGG - Intronic
1055169292 9:73235627-73235649 ATCAGGGACTTGAGCATCCATGG + Intergenic
1061155930 9:128861648-128861670 ACCTGTGCCTTGAGCAACAAAGG + Intronic
1061849352 9:133405341-133405363 AGCAGCGCCTTCAGCAAACCAGG + Exonic
1186932159 X:14405738-14405760 ACCAGGGCCCTTAGGGAACATGG - Intergenic
1188108178 X:26167329-26167351 CCCAAGGCTTTGAGCAAACATGG - Intergenic
1189013340 X:37070141-37070163 CCTAGGGCCTTGAGTGAACATGG - Intergenic
1189263156 X:39692365-39692387 CTCAGGGCCCTGAGCAAACTAGG + Intergenic
1193172951 X:78357906-78357928 CCCAGGGCCTTGAACAAACATGG - Intergenic
1193665449 X:84310306-84310328 CCTTGGGCCTTGAGGAAACATGG + Intergenic
1194285600 X:92007118-92007140 ACCAGGGCCTTGAGCAAACATGG - Intronic
1194656067 X:96575308-96575330 ACAAGGGCCTTGAAAATACATGG + Intergenic
1194791887 X:98160444-98160466 CCCAGGGCCCTGAGCAAACAAGG + Intergenic
1195849062 X:109263817-109263839 ACCAGGGCCTTGAGATGACATGG - Intergenic
1196399460 X:115299301-115299323 TTCAGGGCCTTGAGCAAGCTGGG - Intronic
1196710864 X:118760806-118760828 ATCAGGGACTTGAGCATCCATGG - Intronic
1196785340 X:119417084-119417106 ACCAGGGCCTTGAGCCTCAAGGG + Intronic
1197429520 X:126343024-126343046 CCAAGGACCTTGAGCAAACATGG + Intergenic
1197581458 X:128288783-128288805 ACCAGAGCCTTGAGCAAACGTGG + Intergenic
1199610301 X:149606936-149606958 ATCAGGGACTTGAGCATCCATGG - Intronic
1200603168 Y:5231656-5231678 ACCAGAGCCTTGAGCAAACATGG - Intronic
1200948318 Y:8867637-8867659 ACCAGGTGCTTGAGGGAACAGGG - Intergenic