ID: 1194295158

View in Genome Browser
Species Human (GRCh38)
Location X:92118204-92118226
Sequence CAGTGTTTCTGAAGGGCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 2, 1: 0, 2: 1, 3: 27, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194295158 Original CRISPR CAGTGTTTCTGAAGGGCATA TGG (reversed) Intronic
900874681 1:5333234-5333256 CAGTGCTTGTGATGGGCACAAGG - Intergenic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903383382 1:22911683-22911705 CAGGGTTTCAGAGGGGCATCTGG + Intronic
904076443 1:27846307-27846329 CAGTGTTTCTGGAGCACAGAGGG - Intronic
905772148 1:40645313-40645335 CAGTATTTCTGGAAGGCATGTGG + Intronic
911821473 1:102429301-102429323 CAGTGTTTCTGCAGAGGAAAAGG - Intergenic
913940478 1:125099115-125099137 CAGTTTTTCTGAAGGCTATTTGG - Intergenic
915987911 1:160484925-160484947 CTCTGTTTCTGAAGAGCTTAGGG + Intergenic
918470084 1:184862702-184862724 CTGTGTTTGAGATGGGCATATGG - Intronic
918687386 1:187435255-187435277 AAATGTCTCTGAAGGGCATGAGG - Intergenic
919984249 1:202661732-202661754 GAGTGTTTCTAAAGCGCAAAGGG + Intronic
923267398 1:232327976-232327998 GATTGTTTCTGAAGGTTATAGGG - Intergenic
923669005 1:236024183-236024205 CAGGGATTCTGAAGAGCATCAGG + Exonic
1064435420 10:15306941-15306963 GAGTGTTTTTGAAGGGCACATGG - Intronic
1065307397 10:24381962-24381984 CAGCTTTTCTGAAAGGCAGAAGG + Intronic
1066057860 10:31698209-31698231 CAGTGGTTATTAAGGGCACAGGG - Intergenic
1066162100 10:32744983-32745005 TAGTTTTTGTGAAGGGTATAAGG + Intronic
1067091760 10:43270078-43270100 CACTCTTTTTCAAGGGCATATGG - Intergenic
1069900357 10:71703288-71703310 CAGTGTTTCTGAATGGCCCCCGG - Intronic
1070485327 10:76924962-76924984 CAGCGTTTCTGAAGTGGGTAAGG - Intronic
1070907397 10:80085135-80085157 CAATTTTTTTGAAGGGCAGAGGG + Intronic
1071162932 10:82772483-82772505 CAGTGGTTATTAAGGGCACAAGG - Intronic
1071386250 10:85124249-85124271 CAGTGGTTCTTAAGGGCAGGAGG - Intergenic
1072178856 10:92959325-92959347 CAGTTTTTGTGAAGGGTGTAAGG - Intronic
1072524558 10:96259835-96259857 CAGGGTTTTTGAAGGACACAGGG - Intronic
1074079432 10:110156150-110156172 CAGTTTTACTGAAGGGCACCAGG + Intergenic
1074338424 10:112601814-112601836 TAATTTTTCTGAAGGGCATTGGG + Intronic
1077037696 11:503250-503272 CCGTCTTTCTGAAGGGCAGCTGG - Exonic
1080467121 11:32508134-32508156 CAGTGGTTCTCAAGGGCTTTGGG - Intergenic
1081615001 11:44585612-44585634 CAGTGTTTCCCAAGGTCATGTGG + Intronic
1085072925 11:73564407-73564429 CAGTGATTCTCAAGTGCAGATGG + Intronic
1085790951 11:79497310-79497332 CACTTTTTCTGAAGGCCCTAGGG - Intergenic
1087474793 11:98622018-98622040 CAATTTTTGTGAAGGGTATAAGG + Intergenic
1092001310 12:5034632-5034654 CAGTGTTTCTGAAGTGCTAATGG + Intergenic
1093224426 12:16464713-16464735 CAATGTTCCTGAATGGCATGAGG + Intronic
1095517941 12:43027813-43027835 CAGTGGTTGTCAAGGGCATAGGG - Intergenic
1096363523 12:51008601-51008623 CAGTGTTTCTGGAGATCATGGGG - Exonic
1096812056 12:54177031-54177053 TAGTGTTTCTGGATGGCACACGG + Intronic
1097400509 12:59122996-59123018 CAGTGTTTTTGTAAGGCAAAAGG - Intergenic
1099631514 12:85152317-85152339 CAGTGTTTGTGAAGGGAAGCGGG - Exonic
1100814178 12:98369711-98369733 TAGTGCTTCTGAATGGCACACGG - Intergenic
1101908652 12:108846623-108846645 CAGTATTTCTGAAGGCCTTCTGG - Intronic
1103579653 12:121905086-121905108 CAGTCTTTCTGAAGGACATGTGG - Intronic
1105600023 13:21878504-21878526 CAGTGTGACTGAGGGGCATAGGG - Intergenic
1106848375 13:33762005-33762027 CAGTGTTTCTGAAGTTCATTGGG + Intergenic
1107022432 13:35765620-35765642 CAGTATTTCAGAAGGGCCTGAGG + Intergenic
1108735884 13:53282887-53282909 CAGGGGTTCTGAAGAGCTTATGG - Intergenic
1108976389 13:56448367-56448389 CAGTGTTTTTGAGAGGCATTGGG - Intergenic
1109030280 13:57181279-57181301 CAGGGTTTCTCAAGGGCACTAGG - Intergenic
1110769366 13:79321179-79321201 AAGTGTTTATGAAGGGAATGGGG - Intronic
1114339319 14:21726641-21726663 CAGTGTGTCTGTAGGGCACATGG + Intergenic
1117621256 14:57589413-57589435 CCATGGTTCTGAAGGGCATCTGG - Exonic
1118476328 14:66120853-66120875 CTGTGGTTCTGACAGGCATAGGG + Intergenic
1120035447 14:79691724-79691746 CTATGTTTCTGATGGGAATACGG + Intronic
1121862141 14:97328515-97328537 CAGTCTTTCTTAAGTGAATATGG + Intergenic
1124021708 15:25931416-25931438 CAGTATTTCTGAGGGGAACAAGG + Intergenic
1126461357 15:48918354-48918376 GTGTGTTTCTCAAGGCCATATGG + Intronic
1128447005 15:67771650-67771672 CAGTGTTTGAGAGGTGCATATGG + Intronic
1128676498 15:69613018-69613040 CAGTTCTTCTGAAGGGCAAAGGG - Intergenic
1130015230 15:80180915-80180937 CAGGGTCTCTGAGGGGCATGAGG + Intronic
1131721823 15:95177597-95177619 CAGTGTGGCTAAAGGGTATATGG - Intergenic
1132123041 15:99194591-99194613 CAATTTTTGTGAAGGGTATAAGG - Intronic
1135505656 16:23033848-23033870 CAGTGGGTCTGAAAGGCACATGG - Intergenic
1137088699 16:36161554-36161576 CAGTCTTTCTGAGGGCCATGTGG + Intergenic
1139319771 16:66105035-66105057 CAGTATTTCAGTAGGGGATATGG - Intergenic
1143393897 17:6576746-6576768 CAGTGGGTCTGAAAGGCAGAAGG - Intergenic
1144232970 17:13227704-13227726 CTGAGTTACTGAAGGGCATGGGG + Intergenic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1144698417 17:17321349-17321371 TAGTGTCTGTGAAGGGCAGAGGG + Intronic
1147431170 17:40371689-40371711 CAGTGGTTTGGAAGGGCCTAGGG - Intergenic
1149189206 17:54038447-54038469 CAGTGTTTCTCATGGGGACAGGG - Intergenic
1149311101 17:55394961-55394983 CAGTGTTTGAGAAGGACAAAGGG - Intronic
1150096093 17:62376974-62376996 CAGTGTCTAAGAATGGCATAGGG + Intronic
1150650248 17:67005435-67005457 CAGTGATTCAGAGGGGCAGAAGG - Intronic
1151336921 17:73445514-73445536 CTCTGGTTCTGAAGAGCATAGGG + Intronic
1152378636 17:79930987-79931009 CAGTGTCTCTGAAGGGGCTGGGG - Intergenic
1154336005 18:13465300-13465322 CATTGATTCTGAAGGTCAGATGG + Intronic
1155087424 18:22471934-22471956 CACTGTGTCTGAAGGGCACTGGG - Intergenic
1155167814 18:23245534-23245556 CAGTGTTTCTGCAGTCGATATGG + Intronic
1156113251 18:33754099-33754121 CAGTCTTTCTGATGGACAAAAGG - Intergenic
1156201546 18:34838150-34838172 CAGCTTTTCTGAAGGGCAAAGGG + Intronic
1156377630 18:36529039-36529061 GAGGGTTTCTGGAGGGCAGATGG + Intronic
1156593965 18:38524739-38524761 CAGTTCTTCTGAAGGGAATCTGG - Intergenic
1156613433 18:38753814-38753836 CTGTGTTTCTGAGGGGAACATGG + Intergenic
1158852630 18:61510544-61510566 CACTGCTTCAGAAGGGAATAAGG + Intronic
1159309643 18:66690299-66690321 CAGTCTATCTGCAGGGCAAATGG - Intergenic
1159652246 18:70990846-70990868 CAGTGTTTGTGAAAGACAGATGG + Intergenic
1160184165 18:76661754-76661776 AAATGTTCCTGAAGGGCAAATGG + Intergenic
1161714579 19:5868122-5868144 CAGTGTGTCTGAGGGCCAGAGGG - Intronic
1161900229 19:7113020-7113042 CATTGTTTCTGAAGAGCCTAAGG + Intronic
1164959159 19:32412567-32412589 AAGTGGTTTTGCAGGGCATAGGG + Intronic
925740140 2:6998469-6998491 CAGCCTTTCTTAAGGGCAGAAGG + Intronic
925835565 2:7942819-7942841 CAGTGCTTCTGAATGGTAGAAGG + Intergenic
926075557 2:9940299-9940321 GATTGTTTCAGAAGGGCAGAAGG - Intergenic
926820687 2:16848506-16848528 CAGTGTTTCTGAAAGAGACAAGG - Intergenic
928081937 2:28319610-28319632 CAGTGTTGCTGAAGGAGACAGGG - Intronic
931557298 2:63519245-63519267 CAGTGGCTCTGCAGGGCAGAGGG - Intronic
935284148 2:101548987-101549009 AAGTGTTTATGGAGTGCATATGG + Intergenic
937240862 2:120461515-120461537 CAGATTTTCTGAGGGGCTTATGG + Intergenic
937305590 2:120868597-120868619 CTTTGTTTCTGAATGGCAAAGGG - Intronic
938646922 2:133341358-133341380 CAATGTTTCTAAGGGGGATAAGG + Intronic
942253625 2:174069507-174069529 CAGTGTTACTGAAGTGCTTTAGG - Intergenic
943742779 2:191428518-191428540 CAGTATTTCAGAAAGGAATAGGG + Intergenic
944583811 2:201156153-201156175 AAGTGTTTCTGTAGGCAATAAGG + Intronic
944637607 2:201689924-201689946 CCCTGTTTATGAAGGGCAAATGG + Intronic
945021457 2:205576462-205576484 TAATTTTTGTGAAGGGCATAAGG + Intronic
946663912 2:222029684-222029706 CAGTGTTCCTCAAGGGAAGAGGG + Intergenic
947690665 2:232133095-232133117 CAGTGTTTCTGAGTGGGAGAGGG - Intronic
1169212537 20:3775418-3775440 CAGTGTGTGTGAAGGGCTAACGG - Intergenic
1169389536 20:5178498-5178520 GCGTGTTTTTGAAGGTCATATGG + Intronic
1170433783 20:16302283-16302305 TAGTTTTTGTGAATGGCATAAGG + Intronic
1171313599 20:24166626-24166648 CAGGATTACTGCAGGGCATAGGG + Intergenic
1173174662 20:40755211-40755233 CAGTGTTTCAAAAAGGCACATGG + Intergenic
1175696531 20:61106904-61106926 CAGGGTTGCTGATGGGCAAAGGG - Intergenic
1175784516 20:61704167-61704189 CAGTGTTTGAGAAGTGCAGACGG + Intronic
949738933 3:7207480-7207502 CAGTGTATGTGAAGGGGATAAGG - Intronic
950081930 3:10228797-10228819 CAGTGTTTCCTGAGGGCATTTGG + Intronic
951134415 3:19087294-19087316 TAGTTTTTCTGAAGGGTGTAGGG - Intergenic
952511933 3:34067006-34067028 CAGTGATCCTCAAGGGCTTATGG + Intergenic
954958512 3:54543348-54543370 CAGTGGTTCTCAATTGCATAGGG + Intronic
956004665 3:64765678-64765700 CTGTGTTTCTAAAAGCCATACGG + Intergenic
957509781 3:81172404-81172426 CAGTGTTTCTGAAGGGCCTCAGG + Intergenic
958114230 3:89194376-89194398 CATTGTTTCTGCAAGGCAGAAGG - Intronic
959643642 3:108671504-108671526 CATTGTTTATGAAGGACATTAGG - Intronic
959646457 3:108708617-108708639 TAATTTTTATGAAGGGCATAAGG + Intergenic
960982903 3:123248721-123248743 CAGTGATTCTAAAGTTCATATGG + Intronic
963042436 3:141079580-141079602 CAGTGTTTATGAAGGGCCTGTGG + Intronic
967868473 3:194209710-194209732 CAGTGTTTTTAAAGGCTATAGGG - Intergenic
970564821 4:17321497-17321519 CAGTGTTCCAGAAGGGCTTCTGG + Intergenic
970741462 4:19243169-19243191 CAGTGTTTATGAAGATCAAATGG - Intergenic
976315027 4:83650990-83651012 CAATGTTTCTTAAGGGCCAAAGG - Intergenic
978262513 4:106777758-106777780 TAATATTTGTGAAGGGCATAAGG - Intergenic
978462468 4:108971567-108971589 CAGTGTGTCTGAAGAGGACATGG + Intronic
979322019 4:119335880-119335902 CAGTGTTGCTGCAGTGCACATGG + Intergenic
980532287 4:134071083-134071105 AAGTGTTTGTGGAGGTCATAAGG + Intergenic
981021375 4:140032650-140032672 CAAACTTTCTGAAGGGCATTTGG + Intronic
981286043 4:143020212-143020234 CAGTGACTCAGAAGGGCATATGG + Intergenic
983006982 4:162495185-162495207 CAGTGTTTGTCAAGGGTACAAGG + Intergenic
984750328 4:183266603-183266625 CAGTGACTCTGAAGGGCTCATGG + Intronic
986545376 5:8891413-8891435 CAGTGTTCCTGGATGGCAGAAGG - Intergenic
987818978 5:22936963-22936985 CAATGTTTCTGAAGTGGATCCGG + Intergenic
987850611 5:23348989-23349011 CCTTGTTTCTTAAAGGCATAAGG + Intergenic
988244584 5:28663256-28663278 CAATTTTTGTGAAGGGTATAAGG - Intergenic
989427482 5:41313504-41313526 CTGAGTCTCTGAAGGGAATAGGG - Exonic
990635808 5:57725055-57725077 CTTTGTTTCTGAAGGGCTTGAGG + Intergenic
991968652 5:72116688-72116710 CAGTGTTTCTGATGGGTCAATGG - Intronic
991972679 5:72156135-72156157 CAGTGTTTCTGAAGGAGAGGAGG - Intronic
993336649 5:86667905-86667927 CAGAAGTTCTAAAGGGCATATGG - Intergenic
993663783 5:90670306-90670328 AGGTGTTTCTGAAGGTCAGAGGG + Intronic
993820863 5:92614778-92614800 CAGGGTTTCTGAAGTACATAAGG + Intergenic
995176766 5:109186949-109186971 CAGTGTTTCAGCAGTGCATTGGG - Intronic
997101547 5:130974722-130974744 CTGTGTTTCTAAATGGAATATGG - Intergenic
998571924 5:143268126-143268148 TAATTTTTGTGAAGGGCATAGGG + Intergenic
998894573 5:146785864-146785886 CAGTGGTTGGGAAGGGCATAGGG + Intronic
1001127634 5:169034643-169034665 GAGTGTTTCTAAAAGTCATAAGG + Intronic
1002198004 5:177511628-177511650 CAGTAATTCTGAAGAGCACAGGG + Exonic
1004456742 6:15798448-15798470 CAGTTTGTCAGAAGGGCAGATGG + Intergenic
1005827327 6:29641882-29641904 CACTGTTAGTGAAGGGCAGAAGG - Intergenic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1008941340 6:57048829-57048851 CTGTGTTTCTCAACGGCACATGG - Intronic
1010730461 6:79385339-79385361 TACTGTTTCTGTAGGGCAAAGGG - Intergenic
1014099573 6:117496260-117496282 CAGTTTTTCTGAAAGGAATATGG - Intronic
1016455464 6:144225898-144225920 CAGTGTTTCAGAAGGGAAACAGG + Intergenic
1019088773 6:169506291-169506313 CAGAGTATCTTAATGGCATACGG - Intronic
1020592472 7:10158283-10158305 CAGTATTTCTTAGGGCCATATGG + Intergenic
1020660183 7:10972958-10972980 CACTTTTTCTGCAGGGCAGATGG + Intergenic
1022842578 7:34178907-34178929 CAGTGCCTGTGAAGGACATAGGG + Intergenic
1024281904 7:47725311-47725333 GAGTGATGCTGAAGGGCATGGGG + Intronic
1024521746 7:50310853-50310875 CTGTGTCTCAGAAGGGCAAAGGG - Intronic
1029997550 7:105022866-105022888 CAGTTTTTCTGTAAGGCATATGG + Intronic
1030416281 7:109247426-109247448 CAGTGTTTGCCAAGGGCTTAGGG - Intergenic
1030951678 7:115798373-115798395 CATTCTTTCTGAAGGGTCTAGGG - Intergenic
1031498698 7:122484446-122484468 CAGTATTTCTGGATGGCATATGG - Intronic
1033714353 7:143984486-143984508 CAGTCTTCATGAAGGGTATATGG - Intergenic
1033918174 7:146353995-146354017 CAGTATATGTGAAGGGCCTATGG - Intronic
1035832363 8:2710732-2710754 CAGAGTTTCAGAAGAGAATAAGG + Intergenic
1035862845 8:3048558-3048580 TAATTTTTCTGAAGGGCAAAAGG - Intronic
1035886549 8:3297318-3297340 GAGTGTTTCTGAAATTCATATGG + Intronic
1035922824 8:3696191-3696213 CTGTCTGTTTGAAGGGCATATGG - Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1039609054 8:38904422-38904444 CAGTGCTTCTCAAGAGCATAAGG - Intronic
1042089477 8:65143418-65143440 CAGTGCTTCTGAAAGGCAAATGG - Intergenic
1043160014 8:76834911-76834933 GAATGTTTCTGAAGGATATAAGG + Intronic
1043528879 8:81128080-81128102 CAGTGTTTCCAAAGAGCATTAGG + Intergenic
1043814657 8:84787413-84787435 CAGTATTACTGAAGGGCATTTGG + Intronic
1044884339 8:96760541-96760563 CAGTATTTCTAAAGGGCTTAAGG + Intronic
1046168819 8:110477665-110477687 CAGTATTTGTGTATGGCATAAGG + Intergenic
1048065423 8:130962733-130962755 CAGTGTTTCTGAACAGCTTCAGG + Intronic
1052920955 9:33968554-33968576 CAGTGTTTCTGAGTGGCACGTGG - Intronic
1056123251 9:83510374-83510396 CAGTGTTACTGATGGGCATGTGG + Intronic
1056418948 9:86404808-86404830 AAGTGTTTGTGAAGGGAAGATGG - Intergenic
1059676324 9:116544048-116544070 AAGTGTTTCTGCAGGGAATTTGG - Intronic
1062051350 9:134448678-134448700 CAGTGTCACTGGAGGGCATGTGG + Intergenic
1187255567 X:17638903-17638925 CAGTGTCTCTGGAGGACATTAGG - Intronic
1191210457 X:57879334-57879356 CAGTGTTGCTGAAGTTCAGATGG - Intergenic
1191674852 X:63783927-63783949 CAGTGGTTCTTAAGGGCATCCGG - Intronic
1192579985 X:72272976-72272998 CATTAATTCTGAAGGGCATACGG - Intronic
1193932854 X:87578467-87578489 CAGTGTTTCTGTGGGGAATGAGG - Intronic
1194295158 X:92118204-92118226 CAGTGTTTCTGAAGGGCATATGG - Intronic
1199097511 X:143759639-143759661 CAGTGACTTTGAAGGGCATATGG + Intergenic
1199365954 X:146983216-146983238 ATGTTTTTCTGTAGGGCATAAGG + Intergenic
1199758741 X:150889247-150889269 GAGTGGATCTGAAGGGCAGATGG - Intronic
1200612658 Y:5342728-5342750 CAGTGTTTCTGAAGGGCATATGG - Intronic
1201428393 Y:13879827-13879849 TACTGTTTCTGATGGGCAAAAGG + Intergenic