ID: 1194307864

View in Genome Browser
Species Human (GRCh38)
Location X:92270647-92270669
Sequence GGGAGGATACGGTCTCATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 48}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194307864 Original CRISPR GGGAGGATACGGTCTCATTA TGG Intronic
904106719 1:28090786-28090808 GGAAGGATATGATCTAATTAGGG - Intergenic
905103511 1:35546312-35546334 GTGAGGAAACGGTCTCAAGAAGG + Intronic
905212495 1:36384382-36384404 AGGAGCATACAGTCTAATTAAGG - Intronic
905862057 1:41358367-41358389 GGGAGGAGACAGTCTCTTGAGGG + Intergenic
911270471 1:95795589-95795611 GGGAGGACACGATCTAATTGTGG + Intergenic
912613064 1:111068154-111068176 GGTAGGATAATATCTCATTATGG + Intergenic
1062831282 10:607507-607529 GGGAGCATACGTGCTCATAAAGG - Intronic
1064570967 10:16692908-16692930 AGGAGGATACGGTATCATTTTGG + Intronic
1068734471 10:60396810-60396832 GGTAGGATAAGGTCTCTGTAAGG - Intronic
1069797334 10:71061811-71061833 GGGAGCATACGGTCCCACCACGG + Intergenic
1079939117 11:26655936-26655958 GGCAGGAATCTGTCTCATTAAGG + Intronic
1085528309 11:77176769-77176791 GGGAGGGTAGAGTCTCATGAGGG - Intronic
1088460574 11:110078172-110078194 GGGAAAATATGGTCTCACTATGG + Intergenic
1090853417 11:130590561-130590583 GGTAAGATGCTGTCTCATTATGG + Intergenic
1099773384 12:87093473-87093495 GGGAGGATAGGGTCACCCTAAGG - Intergenic
1100470855 12:94891611-94891633 GGAAGGAAACTTTCTCATTAGGG - Intergenic
1106687522 13:32076768-32076790 GGGAGTCTACAGTCTTATTAGGG + Intronic
1115695925 14:35898459-35898481 GGCAGGATGCAGTCTCATGATGG + Intronic
1124404160 15:29379394-29379416 GGGAGGTTAGGGTATCATTAGGG - Intronic
1129597379 15:76975336-76975358 AGAAGGATAAGGTCTCATTCAGG - Intergenic
1142776286 17:2142054-2142076 GGGAGGACAGGATCTCACTATGG + Intronic
1144323052 17:14149721-14149743 GGGAGGAGCCGGTGTCATGATGG + Intronic
1159740229 18:72158659-72158681 GGGAAGATGCTATCTCATTATGG - Intergenic
1160673808 19:378023-378045 GGGAGGATCCGGTCCCATCAAGG + Intergenic
925849126 2:8063617-8063639 GGGAGGAAAAGGTTTCATTGAGG - Intergenic
1175446754 20:59025755-59025777 TGGAGGACATCGTCTCATTAGGG + Exonic
1178920566 21:36735741-36735763 GTGAGGATACGGACATATTAAGG - Intronic
1180137151 21:45869253-45869275 GGGAGGATTCGGTCTAATCCGGG + Intronic
1184282146 22:43443314-43443336 GGGAGGACAAGGTCTGATTCGGG + Intronic
950220765 3:11194187-11194209 GAGAGGATACTTTCTTATTAAGG + Intronic
966538010 3:181055581-181055603 GGGAAGAGACTGTGTCATTAGGG + Intergenic
967594236 3:191311724-191311746 TAAAGGATACTGTCTCATTAAGG - Intronic
968570326 4:1336982-1337004 GGTAGGATACGGTGTCTTGATGG - Exonic
977527678 4:98164547-98164569 GGGGGGAGACGGTATTATTACGG - Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
986520749 5:8615063-8615085 GGGAAGATACACTCTCAATATGG - Intergenic
995108893 5:108405887-108405909 GGGAGGATACTCTCACATAAAGG - Intergenic
999549995 5:152676272-152676294 AGGAGGATGGGGTTTCATTAAGG - Intergenic
1014410453 6:121111600-121111622 GGGAGGAAAATTTCTCATTATGG + Intronic
1015987171 6:138896108-138896130 GGGAGGACCCCATCTCATTAAGG - Intronic
1019228409 6:170535229-170535251 GGGAGGAAACTGTTTCCTTAAGG - Exonic
1020133728 7:5574476-5574498 GGGAGGATGAGATCTCATTGAGG - Intergenic
1022056610 7:26742205-26742227 GGAATGATCTGGTCTCATTAAGG + Intronic
1022998306 7:35781755-35781777 GAGAGGAGACAGTCTCCTTATGG + Intergenic
1028459659 7:91076938-91076960 GGCATGAGATGGTCTCATTATGG - Intronic
1035659775 8:1338696-1338718 AGGAGCATACGGTCCCATAATGG + Intergenic
1037732023 8:21534127-21534149 GAGAGGATATGATCTCATGAAGG + Intergenic
1052344914 9:27399803-27399825 AGGAAGATACGATCTCATTTGGG - Intronic
1192162995 X:68802628-68802650 GCAAGGATACTGTCTCATCAGGG + Intergenic
1194062987 X:89227598-89227620 GGCAGGATACAGTCCCATTATGG - Intergenic
1194307864 X:92270647-92270669 GGGAGGATACGGTCTCATTATGG + Intronic
1195327426 X:103769073-103769095 GGCAGGAGACAGTCTCAGTAGGG + Intergenic
1200716797 Y:6556266-6556288 GGCAGGATACAGTCCCATTATGG - Intergenic
1202116356 Y:21472043-21472065 GGGAGAATAGAGTCTCACTAGGG - Intergenic