ID: 1194322987

View in Genome Browser
Species Human (GRCh38)
Location X:92475677-92475699
Sequence AAGAAGCCCAAAGAACATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194322987_1194322990 13 Left 1194322987 X:92475677-92475699 CCTTGATGTTCTTTGGGCTTCTT No data
Right 1194322990 X:92475713-92475735 GATAATATTTCACTAGGTATTGG No data
1194322987_1194322989 7 Left 1194322987 X:92475677-92475699 CCTTGATGTTCTTTGGGCTTCTT No data
Right 1194322989 X:92475707-92475729 GATATTGATAATATTTCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194322987 Original CRISPR AAGAAGCCCAAAGAACATCA AGG (reversed) Intronic