ID: 1194322990 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:92475713-92475735 |
| Sequence | GATAATATTTCACTAGGTAT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1194322987_1194322990 | 13 | Left | 1194322987 | X:92475677-92475699 | CCTTGATGTTCTTTGGGCTTCTT | No data | ||
| Right | 1194322990 | X:92475713-92475735 | GATAATATTTCACTAGGTATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1194322990 | Original CRISPR | GATAATATTTCACTAGGTAT TGG | Intronic | ||