ID: 1194324055

View in Genome Browser
Species Human (GRCh38)
Location X:92489101-92489123
Sequence GACTTCTAGCCTGTAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194324053_1194324055 29 Left 1194324053 X:92489049-92489071 CCAAGCATTTTAAAATATGCTCT 0: 2
1: 0
2: 2
3: 40
4: 453
Right 1194324055 X:92489101-92489123 GACTTCTAGCCTGTAAACACAGG 0: 2
1: 0
2: 0
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194324055 Original CRISPR GACTTCTAGCCTGTAAACAC AGG Intronic
901692730 1:10984142-10984164 GACTTCTGGCCTCTAAACCTGGG - Intergenic
904241118 1:29146137-29146159 GACCTTTATCCTGTAAGCACTGG - Intergenic
906269324 1:44462283-44462305 GACTTATACACTATAAACACAGG - Intronic
907657091 1:56355056-56355078 GACATCTATCCTATTAACACAGG - Intergenic
915900013 1:159840127-159840149 GTCTTCAAGCCTGTACCCACTGG + Intronic
919337578 1:196257895-196257917 TACTTCTAACATGAAAACACAGG + Intronic
920946220 1:210531364-210531386 GACCTCTGGCCTGTAAATAAAGG + Intronic
922284561 1:224158076-224158098 AACTTCTAGTCTGTCAAGACTGG - Exonic
1067163228 10:43844513-43844535 GACTACAAGCCTGCAGACACAGG - Intergenic
1071355905 10:84794649-84794671 GTCTTCCAGTCTGTGAACACAGG + Intergenic
1084608398 11:70185751-70185773 GACTTCCAGACTGTAGGCACAGG - Intronic
1090524247 11:127512907-127512929 GTCTTCTAACCTGTGAACATGGG + Intergenic
1093098068 12:14994795-14994817 ACCTTCTCTCCTGTAAACACAGG + Intergenic
1095904887 12:47367705-47367727 CATTTCTAGACTGTAACCACCGG - Intergenic
1106674224 13:31940672-31940694 GATTTCAAGCCAGTAAAAACTGG + Intergenic
1107638858 13:42420634-42420656 GGCTCCAAGCCTGTAAAAACTGG + Intergenic
1109012252 13:56966671-56966693 GACATCAAGCCTGGAAACATGGG - Intergenic
1110242119 13:73280941-73280963 CACTTCTAGACTGAAAACAGTGG + Intergenic
1112702360 13:102025319-102025341 GTCTTCTAGTCTGTAAACATGGG + Intronic
1113606486 13:111611148-111611170 GACTTCAATCCTGTCTACACTGG + Intronic
1116860984 14:49995500-49995522 GACTTCTGTCCAGGAAACACAGG + Intronic
1117974936 14:61287830-61287852 GACTTCTAGCCTCAAAAGATTGG - Intronic
1120254457 14:82101274-82101296 GATTTCCAGCCTGCAAACAAAGG - Intergenic
1123428101 15:20189141-20189163 GACTACCAGACTGTAGACACAGG + Intergenic
1127465164 15:59237009-59237031 GACATGAAGACTGTAAACACAGG + Intronic
1128655430 15:69457899-69457921 GACTTATAGACTGTTAACATTGG - Intergenic
1129198646 15:73985629-73985651 CACTCCTAGCCTGGGAACACAGG + Intronic
1129492047 15:75936923-75936945 GACTGTTAGCCAGTAAAAACAGG + Exonic
1135681770 16:24463396-24463418 GACTTAGAGCCTGGAAACAAAGG + Intergenic
1139156547 16:64449930-64449952 GAATTTTAGCCTTTACACACAGG - Intergenic
1141408678 16:83816945-83816967 AACTTCTAGATTATAAACACTGG + Exonic
1145965969 17:28917520-28917542 GGCTTCTAGTTTTTAAACACAGG - Intronic
1150271730 17:63871187-63871209 GAATTCTAACATTTAAACACTGG - Intergenic
1150275277 17:63894084-63894106 GAATTCTAACATTTAAACACTGG - Intergenic
1150846990 17:68669165-68669187 GTCATCTAGGCTTTAAACACTGG + Intergenic
1153284632 18:3446794-3446816 GACAGCTAGGCTCTAAACACTGG - Intronic
1157910732 18:51615340-51615362 GATTTCTGGCCTTTCAACACAGG - Intergenic
1162253576 19:9468325-9468347 GGTTTCTTGCCTGTTAACACAGG + Exonic
1166254703 19:41595003-41595025 GACTTCTTGCATTTAAACCCAGG - Intronic
925690316 2:6515710-6515732 CACTTCTAGCTGGTAATCACTGG - Intergenic
926028716 2:9566977-9566999 AGCTTGTAGCCTGTAAACTCTGG - Intergenic
930169857 2:48240232-48240254 GAGCTCTAGTCTGTCAACACAGG - Intergenic
930405524 2:50950898-50950920 GAGTTCTAGTCTGTAATCAGTGG + Intronic
939742795 2:145930427-145930449 GAGTTCTAACCTGAAAACAAAGG - Intergenic
940493262 2:154392200-154392222 GCCTTCTTCCCTGTAAATACTGG - Intronic
940560870 2:155294943-155294965 ACATTCTAGCCTGTAAATACAGG - Intergenic
947304460 2:228728404-228728426 GTGTTCTATCCTGTAAAGACAGG + Intergenic
1174801394 20:53565820-53565842 GACTTTTGTCCTGCAAACACTGG + Intergenic
1174805334 20:53600057-53600079 CATTTCTGCCCTGTAAACACAGG - Intronic
1177310565 21:19386982-19387004 GACTTCTGACCTGCAAAAACGGG - Intergenic
1178502423 21:33136733-33136755 GACTTCTTGCCTGGAGACACAGG + Intergenic
1183320816 22:37164137-37164159 GCCATGTAGCCTGTCAACACAGG + Intronic
1184750406 22:46482858-46482880 GATTTATAGCCTGTAGACAAGGG + Intronic
951282386 3:20768309-20768331 GAATTCTAGCCTGAACAAACAGG - Intergenic
953812589 3:46127052-46127074 GTCTTCCAATCTGTAAACACAGG - Intergenic
954595065 3:51817630-51817652 GACCTCTAGCCTCTAATCATGGG + Exonic
963248367 3:143083277-143083299 GAGTTCTAGCCTGAAGCCACAGG - Intergenic
964808699 3:160639496-160639518 GTCTTGGAGCCTTTAAACACAGG + Intergenic
967284255 3:187853340-187853362 AACTTCAAACCTGTAAACAGTGG + Intergenic
970780977 4:19737106-19737128 GACTTCTTGCCTCCAATCACAGG - Intergenic
971664716 4:29467577-29467599 GACTCATTGCCTGTAAACCCTGG - Intergenic
972332604 4:38077937-38077959 GACTTCTTCCTTGTCAACACAGG - Intronic
975451284 4:74529867-74529889 GACTTCATGCCTGTAAACCGAGG - Intergenic
976836792 4:89383655-89383677 GACTTCTTGCCTATAAGCAAGGG - Intergenic
977156497 4:93580437-93580459 AACTACAAGCCTGAAAACACAGG - Intronic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
982561172 4:156929855-156929877 AAGTTCTGGCCTGTCAACACAGG - Intronic
984253245 4:177359813-177359835 AGCTTCTAGCCTGTGTACACTGG + Intronic
984554509 4:181197905-181197927 GACTTCATGCTTTTAAACACTGG + Intergenic
984688262 4:182695904-182695926 GACTTATACCCTACAAACACAGG - Intronic
987842584 5:23239790-23239812 GGCTTCTTCACTGTAAACACTGG - Intergenic
991045627 5:62219463-62219485 GACTACCAGACTGTAGACACAGG + Intergenic
994635595 5:102341554-102341576 GCCTTTTAGCCTGAACACACAGG - Intergenic
994767124 5:103932563-103932585 GACTTCTGGCTTGGAAACAGAGG + Intergenic
995834908 5:116390339-116390361 GGGTTCTAGACTGTAAACACTGG + Intronic
996710009 5:126534838-126534860 AACTTTTAGCCAGGAAACACTGG - Intergenic
997616650 5:135251086-135251108 GACTTCTAGCCTGGACACATGGG - Intronic
999076561 5:148801614-148801636 GGCTTCTAACCTGTAAACATGGG - Intergenic
1000146192 5:158455393-158455415 GGCTTCTACCCAGTAGACACTGG + Intergenic
1000732278 5:164850048-164850070 GAGTTCTAGCCAGTAAAAATAGG - Intergenic
1002118890 5:176986102-176986124 GCCTTCTATCCTGTAGACACAGG - Intronic
1004895702 6:20145727-20145749 GACATCTTGCCTGAAAATACAGG - Intronic
1008417445 6:51259098-51259120 AACATCTAGCCTTTAAAAACAGG - Intergenic
1010151426 6:72737443-72737465 GACTTCTATCCAGAAAACACAGG + Intronic
1015294056 6:131570158-131570180 GACTTCTATCCTCTAAACTATGG + Intergenic
1026216059 7:68350051-68350073 GACTCTTAGCCTGTAAAAATGGG + Intergenic
1029136739 7:98378331-98378353 GACTTCTGTCCTTTTAACACAGG + Intronic
1033373473 7:140734197-140734219 AACTTCTCACCTGCAAACACAGG + Intronic
1035058981 7:156055284-156055306 GACTTCTAGACTGGAAAGAGGGG - Intergenic
1038137027 8:24797698-24797720 GACTTCCAAACTGTAAACTCAGG + Intergenic
1040922428 8:52637191-52637213 GTCTTCCAGTCAGTAAACACAGG + Intronic
1049402635 8:142436407-142436429 GACCTCCAGCCTGAGAACACGGG + Intergenic
1049977723 9:875899-875921 GGCTTCTGGCTTTTAAACACCGG - Intronic
1050701954 9:8349974-8349996 GTCTTTCAGCTTGTAAACACTGG - Intronic
1187133390 X:16524599-16524621 GACTTCTCAGCTGTAAACAGTGG - Intergenic
1189124457 X:38431417-38431439 GACTTCTCATCTGTAAACAGAGG + Intronic
1189580338 X:42399452-42399474 GAGTTCTAGCCTCTATACTCTGG + Intergenic
1194324055 X:92489101-92489123 GACTTCTAGCCTGTAAACACAGG + Intronic
1196710983 X:118762523-118762545 GAATTATAGCCTGTCAACACTGG - Intronic
1200632158 Y:5602194-5602216 GACTTCTAGCCTGTAAACACAGG + Intronic