ID: 1194324283

View in Genome Browser
Species Human (GRCh38)
Location X:92493523-92493545
Sequence CTAGGTCAAAACCCATTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 2, 1: 0, 2: 0, 3: 10, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194324280_1194324283 15 Left 1194324280 X:92493485-92493507 CCTCCTTAGAAGTCAATAAGGTA 0: 1
1: 0
2: 1
3: 5
4: 121
Right 1194324283 X:92493523-92493545 CTAGGTCAAAACCCATTTTTAGG 0: 2
1: 0
2: 0
3: 10
4: 143
1194324281_1194324283 12 Left 1194324281 X:92493488-92493510 CCTTAGAAGTCAATAAGGTAGTA 0: 2
1: 0
2: 0
3: 4
4: 132
Right 1194324283 X:92493523-92493545 CTAGGTCAAAACCCATTTTTAGG 0: 2
1: 0
2: 0
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194324283 Original CRISPR CTAGGTCAAAACCCATTTTT AGG Intronic
908414020 1:63894839-63894861 AAAGGTCAAAACCCTTTCTTTGG + Intronic
909162970 1:72177947-72177969 CTTTTTCAAAACCCATATTTAGG - Intronic
909467491 1:75989402-75989424 AGAGCTCAAAACCAATTTTTAGG - Intergenic
911212409 1:95156282-95156304 CTAGGTCAGAAAACATTTTGAGG + Intronic
912447513 1:109749141-109749163 CCAGGTGAAAACACTTTTTTCGG + Intronic
916093322 1:161326350-161326372 CTGGGTCAAGACCCCTTTTCCGG - Intronic
916779754 1:168012013-168012035 TTAGGTCAATGGCCATTTTTGGG + Intronic
917235096 1:172883401-172883423 GAAGGTCAAAGCACATTTTTTGG - Intergenic
921932695 1:220768164-220768186 GTGGGTCACAACCCATTATTGGG + Intronic
923597656 1:235373267-235373289 CTAGTAAAAAACTCATTTTTAGG + Intronic
1064654930 10:17547399-17547421 CTGGATCAAGACCCCTTTTTTGG - Intergenic
1065505366 10:26425223-26425245 CTAGCTCAAGACCCCTTTTCTGG + Intergenic
1066411331 10:35172386-35172408 CTAGGTCAAAACCATTTTCACGG + Intronic
1071101489 10:82043782-82043804 ATATGTCAAAACCAATTTTGTGG - Intronic
1072127854 10:92463106-92463128 CTTGGTCAAGACACCTTTTTTGG - Intronic
1080087339 11:28300067-28300089 CTAGGTCAGATCACATTTATAGG + Intronic
1081589124 11:44408695-44408717 CTAGTTCAAAACTCCTTTCTGGG + Intergenic
1084025343 11:66444908-66444930 CTAGGTCGAACCCCAGTTTTGGG - Intronic
1084131157 11:67136037-67136059 CCAGGCCAGAAACCATTTTTGGG + Intronic
1085334006 11:75677088-75677110 CTGGGTCAAGATTCATTTTTTGG + Intergenic
1085591772 11:77769420-77769442 TTAGGACAAAAACTATTTTTTGG - Intronic
1088982895 11:114879626-114879648 CTTGGTCACAACCCATCTCTTGG - Intergenic
1089523218 11:119079445-119079467 CTATGTAATAAACCATTTTTTGG - Intronic
1093079613 12:14794588-14794610 CTAGGGCAAAACCCACTTTACGG + Exonic
1094687002 12:32727570-32727592 CTAGGTCAATGCCAAATTTTAGG - Intronic
1098169637 12:67733804-67733826 TAAGGTCAAAACCCCTTTTGTGG - Intergenic
1100642715 12:96498022-96498044 CTAGATCAAAACCCCTTTTCTGG + Intronic
1100642731 12:96498159-96498181 CTGGATCAAAACCCCTTTTCTGG + Intronic
1103043393 12:117714738-117714760 CAATGTCAAAAGACATTTTTGGG + Intronic
1107689377 13:42936855-42936877 CTAGGTGAAAACCAAGGTTTGGG - Intronic
1107881945 13:44840310-44840332 CTAGGACATAGCCCATTTTTAGG - Intergenic
1109972910 13:69793535-69793557 ATAAGTCAAAACACATTTTGAGG + Intronic
1115031364 14:28798879-28798901 TTAGGTCAGAATCCAGTTTTTGG + Intronic
1115101790 14:29710116-29710138 CTTATTCAAAACCCAATTTTAGG - Intronic
1116068581 14:40014039-40014061 CAAGGTCATAACCCCTTTTAAGG - Intergenic
1121843352 14:97152630-97152652 CTTGGCCAACACCCATTTTTTGG + Intergenic
1125296470 15:38208709-38208731 GGAAGTCAAAACACATTTTTTGG - Intergenic
1125783038 15:42288335-42288357 CTAGGTGAAAAACAATCTTTGGG + Intronic
1125796130 15:42405227-42405249 GTAAGTCAAAATCCATTGTTAGG + Intronic
1128946477 15:71826252-71826274 CTAGTTCAACACCCACCTTTGGG + Exonic
1137430269 16:48412850-48412872 CCAGGTTAAAACCCATGCTTAGG - Intronic
1138569528 16:57860537-57860559 CTGGGACAAGACCCATTTTCTGG - Intronic
1140112551 16:72016338-72016360 CTAGGTCAAAACCCACAGTGGGG + Intronic
1140200526 16:72891089-72891111 CTAGGTGAAAACCTAATTTGGGG - Intronic
1140296614 16:73715202-73715224 CTAGGTCTCAACCCATGTTGAGG - Intergenic
1141405415 16:83788362-83788384 CTAGCTCAAAGCCCAGTGTTTGG + Intronic
1144258461 17:13493760-13493782 CAAGGTCAAAGCCTATTATTTGG + Intergenic
1145851661 17:28104900-28104922 CTAGTTCTAAATCCATTTTATGG + Intronic
1148183463 17:45623652-45623674 CTAAGTGTAAACCAATTTTTGGG + Intergenic
1149119568 17:53146047-53146069 CTAGGTCATCACACATTTTCTGG + Intergenic
1155413596 18:25571998-25572020 CCAGGGAAAAACCCATTTTCTGG - Intergenic
1156012644 18:32512494-32512516 CTAGGGCAACACCCACTTTACGG - Intergenic
1159727888 18:71985355-71985377 CAAGGTCAAGACCCTTTTATAGG - Intergenic
1165304806 19:34996866-34996888 GTAGGTCAAGACCCATTTAAGGG + Intronic
926114758 2:10205342-10205364 CCAGGTCAGAACACATTTTGGGG + Intronic
926720713 2:15958176-15958198 CAAGGTCCGAACCCATTTCTAGG - Intergenic
927232764 2:20841615-20841637 TTAAATCAAAAGCCATTTTTAGG - Intergenic
927259125 2:21069284-21069306 CTTGGTCAAAAGCCATGTCTTGG + Intergenic
927435428 2:23062099-23062121 CTAGGTCAAAAATCATGTTATGG - Intergenic
928947185 2:36782037-36782059 CAGGGTCCAAACCCATTTTGAGG - Intronic
932439688 2:71726002-71726024 CTAGGTCCAAACCCAAGTCTTGG + Intergenic
933276301 2:80288059-80288081 ACACCTCAAAACCCATTTTTGGG + Intronic
933761186 2:85673384-85673406 CTAGCTCATTAACCATTTTTTGG - Intergenic
936761075 2:115784280-115784302 GTAAGTCATAACTCATTTTTGGG + Intronic
936917850 2:117658502-117658524 CTTGGTCAAAACATTTTTTTTGG + Intergenic
937936292 2:127248224-127248246 CTAGGGCAAAACCCACTTTACGG - Intergenic
938694663 2:133824412-133824434 TTAGGTCATAACCCATTCATAGG - Intergenic
941329171 2:164156532-164156554 CTATTTAAACACCCATTTTTAGG + Intergenic
941605025 2:167586031-167586053 CTAGGTAAAGCGCCATTTTTTGG + Intergenic
944344514 2:198645880-198645902 TTATGTCACAAACCATTTTTTGG - Intergenic
944654623 2:201865267-201865289 ATAGGTCAAAAATCATTTGTTGG + Intronic
947104174 2:226650854-226650876 AAAGGTCAAAACACATTTTAAGG - Intergenic
948320930 2:237068643-237068665 CTAGGTCACAAGGCATTCTTAGG - Intergenic
948909609 2:240996474-240996496 CTGGGTAACAACCCATTTCTGGG - Intergenic
948956834 2:241299612-241299634 CAAAGTCAAAACCCAAATTTTGG + Intronic
1171295686 20:24014789-24014811 CTTTGTCCAAACCCTTTTTTGGG + Intergenic
1174957855 20:55120666-55120688 CTACTTTAAAAGCCATTTTTTGG + Intergenic
1177748608 21:25252342-25252364 CTTTGTCAAAACCGATTCTTTGG - Intergenic
1177755684 21:25344423-25344445 CTATGTCAACATACATTTTTGGG - Intergenic
1177975111 21:27838954-27838976 TTAAGTAAAAATCCATTTTTTGG - Intergenic
1178022793 21:28429160-28429182 CTAGTAAAAGACCCATTTTTGGG + Intergenic
1178666471 21:34551534-34551556 CTAGTCCAAAACCCATGTTCTGG + Intronic
1179606096 21:42516197-42516219 CTTGGTTTAAACCCAGTTTTTGG - Intronic
1179614640 21:42574355-42574377 CAATGTCAACACACATTTTTAGG + Intronic
1182092707 22:27606875-27606897 TTGGGTCAAAAGCCATTGTTGGG - Intergenic
952196843 3:31084750-31084772 CTAGGGCAGAATCCATTTCTGGG - Intergenic
953201836 3:40784714-40784736 CTAGCTCCCAGCCCATTTTTGGG + Intergenic
957255900 3:77837654-77837676 CTAGGTCCAAAACAATTGTTAGG + Intergenic
962119502 3:132546894-132546916 CTGGGACAAAACCCCTTTTCTGG - Intergenic
962625713 3:137223904-137223926 CTAGGAAAGAAGCCATTTTTCGG + Intergenic
962949403 3:140204245-140204267 CTAGGCCAAAACATGTTTTTGGG - Intronic
965760940 3:172075898-172075920 CCAGGTCAGGACCCATTCTTGGG - Intronic
971099575 4:23448969-23448991 CAAGGTGGAAACTCATTTTTTGG + Intergenic
973024831 4:45254673-45254695 CTAGGTCAAAAATCATTTCAGGG - Intergenic
974856531 4:67467424-67467446 TTAGGTCAAAATTCATTTTTTGG - Intergenic
976817139 4:89161880-89161902 CTAGATCTAAACCCCTTTCTGGG + Intergenic
977378536 4:96239236-96239258 CTAGGTCAGCTCCCATTCTTGGG - Intergenic
977595402 4:98874006-98874028 CTAGTTCATAGCCCATCTTTGGG + Intronic
978379364 4:108110912-108110934 CTAGGTTACAACTCATTTTATGG + Intronic
978519404 4:109600497-109600519 ATAGGTTAAAAGCCATTTTAAGG + Intronic
985369101 4:189266261-189266283 CTAGGTAACAAGCCATATTTGGG + Intergenic
988906157 5:35792120-35792142 CTAAGTCAAAATGCCTTTTTTGG - Intronic
989265341 5:39466878-39466900 CTGGGTGAAAACCCTTTTTTGGG - Intergenic
990090848 5:52046242-52046264 CTAAGTCTAAAACCATTTTACGG + Intronic
997153070 5:131520085-131520107 CAAAGACAATACCCATTTTTTGG - Intronic
998435482 5:142104612-142104634 CTACGTTAAAATCTATTTTTAGG + Intergenic
1000469262 5:161619628-161619650 CTAATTCAAATCCCATTATTTGG + Intronic
1000697597 5:164407104-164407126 TTATGTCAAAATCCATTTTTTGG - Intergenic
1000721130 5:164708806-164708828 CTATTTAAAAACACATTTTTGGG - Intergenic
1004899024 6:20177240-20177262 ATAGGTCTAAACCCATCTGTTGG - Intronic
1006772701 6:36566909-36566931 GCAGGTCAAAACCCATTAGTGGG + Intergenic
1006963568 6:37959001-37959023 CTGGGTCATTACCCATTTGTTGG + Intronic
1011164087 6:84426273-84426295 CTGGGTCTAAACACATTGTTTGG + Intergenic
1013819490 6:114137445-114137467 CAAGTTCAAAACCCAGTTCTTGG - Intronic
1014623488 6:123698355-123698377 CTAGGTCAAAACATTTTTTCTGG + Intergenic
1015700342 6:136029047-136029069 CTAGTTCAAATCCCTTTCTTGGG - Intronic
1016803289 6:148188317-148188339 CTAGATCTGAACCCATCTTTAGG + Intergenic
1017533724 6:155324252-155324274 GCAGGTCATAACCCATTATTGGG - Intergenic
1021419592 7:20430701-20430723 CTTGGTTAAAACCAACTTTTGGG + Intergenic
1021503979 7:21360646-21360668 CAAAGTGAAAACCCATATTTGGG + Intergenic
1021852928 7:24826253-24826275 CAAGGTTGAAACCGATTTTTTGG + Intronic
1022916228 7:34956801-34956823 TTATTTAAAAACCCATTTTTCGG - Intronic
1025267302 7:57474286-57474308 GAAAGTAAAAACCCATTTTTTGG + Intergenic
1027542268 7:79481963-79481985 CCAGGACAAAACTCATGTTTTGG - Intergenic
1028068432 7:86417911-86417933 CTATTTTAAGACCCATTTTTTGG - Intergenic
1029532310 7:101133616-101133638 CTAGGTGAAAACCCAGTGCTGGG + Intronic
1029923274 7:104288716-104288738 ATGGATCAAAACCCATTTGTGGG + Intergenic
1033878583 7:145853780-145853802 TTAGGTGAAAGGCCATTTTTTGG - Intergenic
1033945661 7:146714867-146714889 CTAGGTCTAGACCCATTATTTGG + Intronic
1033992811 7:147308646-147308668 ATAGGTCAAAAGTCATTTTCAGG - Intronic
1034700861 7:153094665-153094687 CAAGGGGAAAAGCCATTTTTAGG - Intergenic
1036557042 8:9869332-9869354 CATGGTGAAACCCCATTTTTAGG + Intergenic
1039903362 8:41768148-41768170 AGATGTCAAAACCCATGTTTGGG + Intronic
1043378985 8:79682782-79682804 ATAGAACAAAACCCATTTTGGGG - Intergenic
1046356473 8:113092443-113092465 CCAGCTAAAATCCCATTTTTAGG - Intronic
1046679717 8:117155294-117155316 CTAACTCAAAACCCATGATTAGG - Intronic
1047857962 8:128933266-128933288 ATATGCCAAAACCCGTTTTTGGG + Intergenic
1050674594 9:8037260-8037282 GTAGGAAAAAACCCATTTTAGGG - Intergenic
1050782520 9:9355475-9355497 GTGGGTTAAAAACCATTTTTAGG + Intronic
1052547460 9:29898559-29898581 CAAGGTCAAAACACCATTTTTGG + Intergenic
1054896386 9:70317431-70317453 CCAGTTTAAAACTCATTTTTAGG + Intronic
1056914866 9:90737718-90737740 CCAGGCTAAAACCCAATTTTGGG - Intergenic
1058323797 9:103669894-103669916 CTAGGGAGAAACACATTTTTGGG + Intergenic
1185916956 X:4046368-4046390 CTACATCAAAACCCCTTTTCTGG - Intergenic
1186169765 X:6864400-6864422 CTAGGTCCAGCCCCACTTTTTGG + Intergenic
1186726729 X:12366025-12366047 ATAAGGCAAAACACATTTTTAGG - Intronic
1187566470 X:20454472-20454494 CTAGGTCCCAATCCATTTTGGGG + Intergenic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1190593751 X:52032422-52032444 CTGGGTCATAACTTATTTTTCGG + Intergenic
1194324283 X:92493523-92493545 CTAGGTCAAAACCCATTTTTAGG + Intronic
1194675322 X:96787305-96787327 TTAGTTCAAAATCCATTTATTGG - Intronic
1198535919 X:137586132-137586154 CTATGTCAAAACCCAGTTCAAGG - Intergenic
1199059638 X:143339695-143339717 TTTGGTCAAATCCCATTTGTAGG + Intergenic
1200633025 Y:5612744-5612766 CTAGGTCAAAACCCATTTTTAGG + Intronic
1202064909 Y:20928577-20928599 CTAGGTCAGTACCTCTTTTTTGG - Intergenic