ID: 1194339621

View in Genome Browser
Species Human (GRCh38)
Location X:92692718-92692740
Sequence GCTGCGAAAATGAATCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194339621_1194339626 17 Left 1194339621 X:92692718-92692740 CCTTCAGGATTCATTTTCGCAGC No data
Right 1194339626 X:92692758-92692780 AAGATGGCTCACTGAAGATTGGG No data
1194339621_1194339625 16 Left 1194339621 X:92692718-92692740 CCTTCAGGATTCATTTTCGCAGC No data
Right 1194339625 X:92692757-92692779 CAAGATGGCTCACTGAAGATTGG No data
1194339621_1194339623 1 Left 1194339621 X:92692718-92692740 CCTTCAGGATTCATTTTCGCAGC No data
Right 1194339623 X:92692742-92692764 TGTGGCACAAGCCTGCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194339621 Original CRISPR GCTGCGAAAATGAATCCTGA AGG (reversed) Intergenic
No off target data available for this crispr