ID: 1194341375

View in Genome Browser
Species Human (GRCh38)
Location X:92710341-92710363
Sequence CTTATTGAAGCCATGATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194341375_1194341377 2 Left 1194341375 X:92710341-92710363 CCCTGGATCATGGCTTCAATAAG No data
Right 1194341377 X:92710366-92710388 TACATTAAAGCTCATGTTTTAGG No data
1194341375_1194341378 3 Left 1194341375 X:92710341-92710363 CCCTGGATCATGGCTTCAATAAG No data
Right 1194341378 X:92710367-92710389 ACATTAAAGCTCATGTTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194341375 Original CRISPR CTTATTGAAGCCATGATCCA GGG (reversed) Intergenic
No off target data available for this crispr