ID: 1194341554

View in Genome Browser
Species Human (GRCh38)
Location X:92712220-92712242
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194341548_1194341554 12 Left 1194341548 X:92712185-92712207 CCAGTTGGTAAGATGTACAGGTA No data
Right 1194341554 X:92712220-92712242 GCTTGCAATTGGCATGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194341554 Original CRISPR GCTTGCAATTGGCATGTGGA GGG Intergenic
No off target data available for this crispr