ID: 1194354927

View in Genome Browser
Species Human (GRCh38)
Location X:92870973-92870995
Sequence AAAGGGAGACTATACTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194354921_1194354927 18 Left 1194354921 X:92870932-92870954 CCTTTGATTAGATTACTAATCAG No data
Right 1194354927 X:92870973-92870995 AAAGGGAGACTATACTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194354927 Original CRISPR AAAGGGAGACTATACTGGGT GGG Intergenic
No off target data available for this crispr