ID: 1194355172

View in Genome Browser
Species Human (GRCh38)
Location X:92874210-92874232
Sequence CAAGCTACTTTCCGTGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194355172_1194355173 17 Left 1194355172 X:92874210-92874232 CCTTTTTCACGGAAAGTAGCTTG No data
Right 1194355173 X:92874250-92874272 GCTTCCTGCCAGTAGAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194355172 Original CRISPR CAAGCTACTTTCCGTGAAAA AGG (reversed) Intergenic
No off target data available for this crispr