ID: 1194358828

View in Genome Browser
Species Human (GRCh38)
Location X:92921470-92921492
Sequence TTAAACTATCATATGAGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194358827_1194358828 3 Left 1194358827 X:92921444-92921466 CCAAGCACTGTACATACATTACT No data
Right 1194358828 X:92921470-92921492 TTAAACTATCATATGAGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194358828 Original CRISPR TTAAACTATCATATGAGAAT AGG Intergenic
No off target data available for this crispr