ID: 1194371199

View in Genome Browser
Species Human (GRCh38)
Location X:93074308-93074330
Sequence GTTTCATTGCTGAAAGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194371199_1194371206 20 Left 1194371199 X:93074308-93074330 CCCCCCACTTTCAGCAATGAAAC No data
Right 1194371206 X:93074351-93074373 GAAAAAAAAATAAGAAACATGGG No data
1194371199_1194371205 19 Left 1194371199 X:93074308-93074330 CCCCCCACTTTCAGCAATGAAAC No data
Right 1194371205 X:93074350-93074372 AGAAAAAAAAATAAGAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194371199 Original CRISPR GTTTCATTGCTGAAAGTGGG GGG (reversed) Intergenic
No off target data available for this crispr