ID: 1194375598

View in Genome Browser
Species Human (GRCh38)
Location X:93129037-93129059
Sequence ATTTTTACATAGCCTTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194375598_1194375605 28 Left 1194375598 X:93129037-93129059 CCTCAGCAAGGCTATGTAAAAAT No data
Right 1194375605 X:93129088-93129110 GTACAAGAGAATATAGCTTTTGG No data
1194375598_1194375600 -2 Left 1194375598 X:93129037-93129059 CCTCAGCAAGGCTATGTAAAAAT No data
Right 1194375600 X:93129058-93129080 ATCAATGCTATGGATGCCTGTGG No data
1194375598_1194375602 0 Left 1194375598 X:93129037-93129059 CCTCAGCAAGGCTATGTAAAAAT No data
Right 1194375602 X:93129060-93129082 CAATGCTATGGATGCCTGTGGGG No data
1194375598_1194375601 -1 Left 1194375598 X:93129037-93129059 CCTCAGCAAGGCTATGTAAAAAT No data
Right 1194375601 X:93129059-93129081 TCAATGCTATGGATGCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194375598 Original CRISPR ATTTTTACATAGCCTTGCTG AGG (reversed) Intergenic
No off target data available for this crispr