ID: 1194375602

View in Genome Browser
Species Human (GRCh38)
Location X:93129060-93129082
Sequence CAATGCTATGGATGCCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194375597_1194375602 1 Left 1194375597 X:93129036-93129058 CCCTCAGCAAGGCTATGTAAAAA No data
Right 1194375602 X:93129060-93129082 CAATGCTATGGATGCCTGTGGGG No data
1194375598_1194375602 0 Left 1194375598 X:93129037-93129059 CCTCAGCAAGGCTATGTAAAAAT No data
Right 1194375602 X:93129060-93129082 CAATGCTATGGATGCCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194375602 Original CRISPR CAATGCTATGGATGCCTGTG GGG Intergenic