ID: 1194375605 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:93129088-93129110 |
Sequence | GTACAAGAGAATATAGCTTT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1194375598_1194375605 | 28 | Left | 1194375598 | X:93129037-93129059 | CCTCAGCAAGGCTATGTAAAAAT | No data | ||
Right | 1194375605 | X:93129088-93129110 | GTACAAGAGAATATAGCTTTTGG | No data | ||||
1194375597_1194375605 | 29 | Left | 1194375597 | X:93129036-93129058 | CCCTCAGCAAGGCTATGTAAAAA | No data | ||
Right | 1194375605 | X:93129088-93129110 | GTACAAGAGAATATAGCTTTTGG | No data | ||||
1194375603_1194375605 | -9 | Left | 1194375603 | X:93129074-93129096 | CCTGTGGGGTCCAAGTACAAGAG | No data | ||
Right | 1194375605 | X:93129088-93129110 | GTACAAGAGAATATAGCTTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1194375605 | Original CRISPR | GTACAAGAGAATATAGCTTT TGG | Intergenic | ||