ID: 1194375605

View in Genome Browser
Species Human (GRCh38)
Location X:93129088-93129110
Sequence GTACAAGAGAATATAGCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194375598_1194375605 28 Left 1194375598 X:93129037-93129059 CCTCAGCAAGGCTATGTAAAAAT No data
Right 1194375605 X:93129088-93129110 GTACAAGAGAATATAGCTTTTGG No data
1194375597_1194375605 29 Left 1194375597 X:93129036-93129058 CCCTCAGCAAGGCTATGTAAAAA No data
Right 1194375605 X:93129088-93129110 GTACAAGAGAATATAGCTTTTGG No data
1194375603_1194375605 -9 Left 1194375603 X:93129074-93129096 CCTGTGGGGTCCAAGTACAAGAG No data
Right 1194375605 X:93129088-93129110 GTACAAGAGAATATAGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194375605 Original CRISPR GTACAAGAGAATATAGCTTT TGG Intergenic