ID: 1194379907 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:93178943-93178965 |
Sequence | TGGGACTCCTTGGGAAAAAT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1194379901_1194379907 | -2 | Left | 1194379901 | X:93178922-93178944 | CCTGGATGGCTTCTGATGACCTG | No data | ||
Right | 1194379907 | X:93178943-93178965 | TGGGACTCCTTGGGAAAAATAGG | No data | ||||
1194379897_1194379907 | 25 | Left | 1194379897 | X:93178895-93178917 | CCACTCTTGGTGCACACATGAGA | No data | ||
Right | 1194379907 | X:93178943-93178965 | TGGGACTCCTTGGGAAAAATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1194379907 | Original CRISPR | TGGGACTCCTTGGGAAAAAT AGG | Intergenic | ||
No off target data available for this crispr |