ID: 1194379907

View in Genome Browser
Species Human (GRCh38)
Location X:93178943-93178965
Sequence TGGGACTCCTTGGGAAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194379901_1194379907 -2 Left 1194379901 X:93178922-93178944 CCTGGATGGCTTCTGATGACCTG No data
Right 1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG No data
1194379897_1194379907 25 Left 1194379897 X:93178895-93178917 CCACTCTTGGTGCACACATGAGA No data
Right 1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194379907 Original CRISPR TGGGACTCCTTGGGAAAAAT AGG Intergenic
No off target data available for this crispr