ID: 1194380863

View in Genome Browser
Species Human (GRCh38)
Location X:93190509-93190531
Sequence GTGGGTTCTCTTAGCTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194380863_1194380873 26 Left 1194380863 X:93190509-93190531 CCAGGAAAGCTAAGAGAACCCAC No data
Right 1194380873 X:93190558-93190580 ACGGCAGGCTCCCTGAGATGTGG No data
1194380863_1194380864 -9 Left 1194380863 X:93190509-93190531 CCAGGAAAGCTAAGAGAACCCAC No data
Right 1194380864 X:93190523-93190545 AGAACCCACAGACCCTTTGAAGG No data
1194380863_1194380870 7 Left 1194380863 X:93190509-93190531 CCAGGAAAGCTAAGAGAACCCAC No data
Right 1194380870 X:93190539-93190561 TTGAAGGAACTGGATAGCCACGG No data
1194380863_1194380867 -3 Left 1194380863 X:93190509-93190531 CCAGGAAAGCTAAGAGAACCCAC No data
Right 1194380867 X:93190529-93190551 CACAGACCCTTTGAAGGAACTGG 0: 47
1: 97
2: 297
3: 298
4: 336
1194380863_1194380871 11 Left 1194380863 X:93190509-93190531 CCAGGAAAGCTAAGAGAACCCAC No data
Right 1194380871 X:93190543-93190565 AGGAACTGGATAGCCACGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194380863 Original CRISPR GTGGGTTCTCTTAGCTTTCC TGG (reversed) Intergenic
No off target data available for this crispr