ID: 1194380870

View in Genome Browser
Species Human (GRCh38)
Location X:93190539-93190561
Sequence TTGAAGGAACTGGATAGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194380863_1194380870 7 Left 1194380863 X:93190509-93190531 CCAGGAAAGCTAAGAGAACCCAC No data
Right 1194380870 X:93190539-93190561 TTGAAGGAACTGGATAGCCACGG No data
1194380860_1194380870 30 Left 1194380860 X:93190486-93190508 CCAAGAACTACCACAGGAACATA 0: 54
1: 135
2: 178
3: 177
4: 375
Right 1194380870 X:93190539-93190561 TTGAAGGAACTGGATAGCCACGG No data
1194380862_1194380870 20 Left 1194380862 X:93190496-93190518 CCACAGGAACATACCAGGAAAGC 0: 57
1: 120
2: 108
3: 114
4: 248
Right 1194380870 X:93190539-93190561 TTGAAGGAACTGGATAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194380870 Original CRISPR TTGAAGGAACTGGATAGCCA CGG Intergenic
No off target data available for this crispr