ID: 1194380871

View in Genome Browser
Species Human (GRCh38)
Location X:93190543-93190565
Sequence AGGAACTGGATAGCCACGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194380865_1194380871 -7 Left 1194380865 X:93190527-93190549 CCCACAGACCCTTTGAAGGAACT No data
Right 1194380871 X:93190543-93190565 AGGAACTGGATAGCCACGGCAGG No data
1194380863_1194380871 11 Left 1194380863 X:93190509-93190531 CCAGGAAAGCTAAGAGAACCCAC No data
Right 1194380871 X:93190543-93190565 AGGAACTGGATAGCCACGGCAGG No data
1194380862_1194380871 24 Left 1194380862 X:93190496-93190518 CCACAGGAACATACCAGGAAAGC 0: 57
1: 120
2: 108
3: 114
4: 248
Right 1194380871 X:93190543-93190565 AGGAACTGGATAGCCACGGCAGG No data
1194380866_1194380871 -8 Left 1194380866 X:93190528-93190550 CCACAGACCCTTTGAAGGAACTG 0: 59
1: 95
2: 231
3: 332
4: 596
Right 1194380871 X:93190543-93190565 AGGAACTGGATAGCCACGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194380871 Original CRISPR AGGAACTGGATAGCCACGGC AGG Intergenic
No off target data available for this crispr