ID: 1194380873

View in Genome Browser
Species Human (GRCh38)
Location X:93190558-93190580
Sequence ACGGCAGGCTCCCTGAGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194380868_1194380873 0 Left 1194380868 X:93190535-93190557 CCCTTTGAAGGAACTGGATAGCC No data
Right 1194380873 X:93190558-93190580 ACGGCAGGCTCCCTGAGATGTGG No data
1194380869_1194380873 -1 Left 1194380869 X:93190536-93190558 CCTTTGAAGGAACTGGATAGCCA No data
Right 1194380873 X:93190558-93190580 ACGGCAGGCTCCCTGAGATGTGG No data
1194380866_1194380873 7 Left 1194380866 X:93190528-93190550 CCACAGACCCTTTGAAGGAACTG 0: 59
1: 95
2: 231
3: 332
4: 596
Right 1194380873 X:93190558-93190580 ACGGCAGGCTCCCTGAGATGTGG No data
1194380865_1194380873 8 Left 1194380865 X:93190527-93190549 CCCACAGACCCTTTGAAGGAACT No data
Right 1194380873 X:93190558-93190580 ACGGCAGGCTCCCTGAGATGTGG No data
1194380863_1194380873 26 Left 1194380863 X:93190509-93190531 CCAGGAAAGCTAAGAGAACCCAC No data
Right 1194380873 X:93190558-93190580 ACGGCAGGCTCCCTGAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194380873 Original CRISPR ACGGCAGGCTCCCTGAGATG TGG Intergenic
No off target data available for this crispr