ID: 1194382007 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:93204946-93204968 |
| Sequence | GACCGTGAACGTGGTGCTGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1194382007_1194382016 | 26 | Left | 1194382007 | X:93204946-93204968 | CCACCAGCACCACGTTCACGGTC | No data | ||
| Right | 1194382016 | X:93204995-93205017 | CTCCAAGGACACACACATCTAGG | No data | ||||
| 1194382007_1194382015 | 11 | Left | 1194382007 | X:93204946-93204968 | CCACCAGCACCACGTTCACGGTC | No data | ||
| Right | 1194382015 | X:93204980-93205002 | GCAGTTAAGCATATGCTCCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1194382007 | Original CRISPR | GACCGTGAACGTGGTGCTGG TGG (reversed) | Intergenic | ||