ID: 1194382007

View in Genome Browser
Species Human (GRCh38)
Location X:93204946-93204968
Sequence GACCGTGAACGTGGTGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194382007_1194382016 26 Left 1194382007 X:93204946-93204968 CCACCAGCACCACGTTCACGGTC No data
Right 1194382016 X:93204995-93205017 CTCCAAGGACACACACATCTAGG No data
1194382007_1194382015 11 Left 1194382007 X:93204946-93204968 CCACCAGCACCACGTTCACGGTC No data
Right 1194382015 X:93204980-93205002 GCAGTTAAGCATATGCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194382007 Original CRISPR GACCGTGAACGTGGTGCTGG TGG (reversed) Intergenic