ID: 1194388793

View in Genome Browser
Species Human (GRCh38)
Location X:93290577-93290599
Sequence ACTTTTGCACTCATGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194388790_1194388793 20 Left 1194388790 X:93290534-93290556 CCAATATCAAACGGCAAATTTCA 0: 6
1: 67
2: 91
3: 104
4: 238
Right 1194388793 X:93290577-93290599 ACTTTTGCACTCATGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194388793 Original CRISPR ACTTTTGCACTCATGTGTTG GGG Intergenic
No off target data available for this crispr