ID: 1194388919

View in Genome Browser
Species Human (GRCh38)
Location X:93292407-93292429
Sequence ATGGCTGGATGGCCTCTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194388919_1194388925 9 Left 1194388919 X:93292407-93292429 CCCGGCAGAGGCCATCCAGCCAT No data
Right 1194388925 X:93292439-93292461 AGAGACTGTGCACTTGAAAGAGG No data
1194388919_1194388928 27 Left 1194388919 X:93292407-93292429 CCCGGCAGAGGCCATCCAGCCAT No data
Right 1194388928 X:93292457-93292479 AGAGGGAGAATGCAGTGACTGGG No data
1194388919_1194388927 26 Left 1194388919 X:93292407-93292429 CCCGGCAGAGGCCATCCAGCCAT No data
Right 1194388927 X:93292456-93292478 AAGAGGGAGAATGCAGTGACTGG No data
1194388919_1194388926 10 Left 1194388919 X:93292407-93292429 CCCGGCAGAGGCCATCCAGCCAT No data
Right 1194388926 X:93292440-93292462 GAGACTGTGCACTTGAAAGAGGG No data
1194388919_1194388929 28 Left 1194388919 X:93292407-93292429 CCCGGCAGAGGCCATCCAGCCAT No data
Right 1194388929 X:93292458-93292480 GAGGGAGAATGCAGTGACTGGGG 0: 4
1: 18
2: 58
3: 171
4: 562
1194388919_1194388930 29 Left 1194388919 X:93292407-93292429 CCCGGCAGAGGCCATCCAGCCAT No data
Right 1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194388919 Original CRISPR ATGGCTGGATGGCCTCTGCC GGG (reversed) Intergenic
No off target data available for this crispr