ID: 1194388923

View in Genome Browser
Species Human (GRCh38)
Location X:93292426-93292448
Sequence CACAGTCTCTCTGTGTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194388923_1194388929 9 Left 1194388923 X:93292426-93292448 CCATCCAACACAGAGAGACTGTG No data
Right 1194388929 X:93292458-93292480 GAGGGAGAATGCAGTGACTGGGG 0: 4
1: 18
2: 58
3: 171
4: 562
1194388923_1194388926 -9 Left 1194388923 X:93292426-93292448 CCATCCAACACAGAGAGACTGTG No data
Right 1194388926 X:93292440-93292462 GAGACTGTGCACTTGAAAGAGGG No data
1194388923_1194388925 -10 Left 1194388923 X:93292426-93292448 CCATCCAACACAGAGAGACTGTG No data
Right 1194388925 X:93292439-93292461 AGAGACTGTGCACTTGAAAGAGG No data
1194388923_1194388930 10 Left 1194388923 X:93292426-93292448 CCATCCAACACAGAGAGACTGTG No data
Right 1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG No data
1194388923_1194388928 8 Left 1194388923 X:93292426-93292448 CCATCCAACACAGAGAGACTGTG No data
Right 1194388928 X:93292457-93292479 AGAGGGAGAATGCAGTGACTGGG No data
1194388923_1194388927 7 Left 1194388923 X:93292426-93292448 CCATCCAACACAGAGAGACTGTG No data
Right 1194388927 X:93292456-93292478 AAGAGGGAGAATGCAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194388923 Original CRISPR CACAGTCTCTCTGTGTTGGA TGG (reversed) Intergenic
No off target data available for this crispr