ID: 1194388925

View in Genome Browser
Species Human (GRCh38)
Location X:93292439-93292461
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194388919_1194388925 9 Left 1194388919 X:93292407-93292429 CCCGGCAGAGGCCATCCAGCCAT No data
Right 1194388925 X:93292439-93292461 AGAGACTGTGCACTTGAAAGAGG No data
1194388917_1194388925 14 Left 1194388917 X:93292402-93292424 CCATCCCCGGCAGAGGCCATCCA No data
Right 1194388925 X:93292439-93292461 AGAGACTGTGCACTTGAAAGAGG No data
1194388920_1194388925 8 Left 1194388920 X:93292408-93292430 CCGGCAGAGGCCATCCAGCCATC No data
Right 1194388925 X:93292439-93292461 AGAGACTGTGCACTTGAAAGAGG No data
1194388913_1194388925 22 Left 1194388913 X:93292394-93292416 CCCCTGCTCCATCCCCGGCAGAG No data
Right 1194388925 X:93292439-93292461 AGAGACTGTGCACTTGAAAGAGG No data
1194388914_1194388925 21 Left 1194388914 X:93292395-93292417 CCCTGCTCCATCCCCGGCAGAGG No data
Right 1194388925 X:93292439-93292461 AGAGACTGTGCACTTGAAAGAGG No data
1194388921_1194388925 -2 Left 1194388921 X:93292418-93292440 CCATCCAGCCATCCAACACAGAG No data
Right 1194388925 X:93292439-93292461 AGAGACTGTGCACTTGAAAGAGG No data
1194388916_1194388925 20 Left 1194388916 X:93292396-93292418 CCTGCTCCATCCCCGGCAGAGGC No data
Right 1194388925 X:93292439-93292461 AGAGACTGTGCACTTGAAAGAGG No data
1194388923_1194388925 -10 Left 1194388923 X:93292426-93292448 CCATCCAACACAGAGAGACTGTG No data
Right 1194388925 X:93292439-93292461 AGAGACTGTGCACTTGAAAGAGG No data
1194388922_1194388925 -6 Left 1194388922 X:93292422-93292444 CCAGCCATCCAACACAGAGAGAC No data
Right 1194388925 X:93292439-93292461 AGAGACTGTGCACTTGAAAGAGG No data
1194388918_1194388925 10 Left 1194388918 X:93292406-93292428 CCCCGGCAGAGGCCATCCAGCCA No data
Right 1194388925 X:93292439-93292461 AGAGACTGTGCACTTGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194388925 Original CRISPR AGAGACTGTGCACTTGAAAG AGG Intergenic
No off target data available for this crispr