ID: 1194388928

View in Genome Browser
Species Human (GRCh38)
Location X:93292457-93292479
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194388920_1194388928 26 Left 1194388920 X:93292408-93292430 CCGGCAGAGGCCATCCAGCCATC No data
Right 1194388928 X:93292457-93292479 AGAGGGAGAATGCAGTGACTGGG No data
1194388921_1194388928 16 Left 1194388921 X:93292418-93292440 CCATCCAGCCATCCAACACAGAG No data
Right 1194388928 X:93292457-93292479 AGAGGGAGAATGCAGTGACTGGG No data
1194388919_1194388928 27 Left 1194388919 X:93292407-93292429 CCCGGCAGAGGCCATCCAGCCAT No data
Right 1194388928 X:93292457-93292479 AGAGGGAGAATGCAGTGACTGGG No data
1194388923_1194388928 8 Left 1194388923 X:93292426-93292448 CCATCCAACACAGAGAGACTGTG No data
Right 1194388928 X:93292457-93292479 AGAGGGAGAATGCAGTGACTGGG No data
1194388924_1194388928 4 Left 1194388924 X:93292430-93292452 CCAACACAGAGAGACTGTGCACT No data
Right 1194388928 X:93292457-93292479 AGAGGGAGAATGCAGTGACTGGG No data
1194388922_1194388928 12 Left 1194388922 X:93292422-93292444 CCAGCCATCCAACACAGAGAGAC No data
Right 1194388928 X:93292457-93292479 AGAGGGAGAATGCAGTGACTGGG No data
1194388918_1194388928 28 Left 1194388918 X:93292406-93292428 CCCCGGCAGAGGCCATCCAGCCA No data
Right 1194388928 X:93292457-93292479 AGAGGGAGAATGCAGTGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194388928 Original CRISPR AGAGGGAGAATGCAGTGACT GGG Intergenic
No off target data available for this crispr