ID: 1194388929

View in Genome Browser
Species Human (GRCh38)
Location X:93292458-93292480
Sequence GAGGGAGAATGCAGTGACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 813
Summary {0: 4, 1: 18, 2: 58, 3: 171, 4: 562}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194388920_1194388929 27 Left 1194388920 X:93292408-93292430 CCGGCAGAGGCCATCCAGCCATC No data
Right 1194388929 X:93292458-93292480 GAGGGAGAATGCAGTGACTGGGG 0: 4
1: 18
2: 58
3: 171
4: 562
1194388923_1194388929 9 Left 1194388923 X:93292426-93292448 CCATCCAACACAGAGAGACTGTG No data
Right 1194388929 X:93292458-93292480 GAGGGAGAATGCAGTGACTGGGG 0: 4
1: 18
2: 58
3: 171
4: 562
1194388922_1194388929 13 Left 1194388922 X:93292422-93292444 CCAGCCATCCAACACAGAGAGAC No data
Right 1194388929 X:93292458-93292480 GAGGGAGAATGCAGTGACTGGGG 0: 4
1: 18
2: 58
3: 171
4: 562
1194388918_1194388929 29 Left 1194388918 X:93292406-93292428 CCCCGGCAGAGGCCATCCAGCCA No data
Right 1194388929 X:93292458-93292480 GAGGGAGAATGCAGTGACTGGGG 0: 4
1: 18
2: 58
3: 171
4: 562
1194388921_1194388929 17 Left 1194388921 X:93292418-93292440 CCATCCAGCCATCCAACACAGAG No data
Right 1194388929 X:93292458-93292480 GAGGGAGAATGCAGTGACTGGGG 0: 4
1: 18
2: 58
3: 171
4: 562
1194388919_1194388929 28 Left 1194388919 X:93292407-93292429 CCCGGCAGAGGCCATCCAGCCAT No data
Right 1194388929 X:93292458-93292480 GAGGGAGAATGCAGTGACTGGGG 0: 4
1: 18
2: 58
3: 171
4: 562
1194388924_1194388929 5 Left 1194388924 X:93292430-93292452 CCAACACAGAGAGACTGTGCACT No data
Right 1194388929 X:93292458-93292480 GAGGGAGAATGCAGTGACTGGGG 0: 4
1: 18
2: 58
3: 171
4: 562

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194388929 Original CRISPR GAGGGAGAATGCAGTGACTG GGG Intergenic
900300214 1:1973350-1973372 GAGGGAGGAGGCAGGGGCTGGGG + Intronic
900578742 1:3397197-3397219 GAGGGAAAATGCGGGGTCTGAGG + Intronic
900951066 1:5858525-5858547 GAGAGAGAATGGAGTGGCAGGGG - Intergenic
901230612 1:7639973-7639995 GAGGGAGAGGGCAGTGGCTGTGG + Intronic
901771169 1:11531064-11531086 GAGGGAGGATGGACTGACTGGGG + Intronic
901773443 1:11543065-11543087 CAGGCAGAGTGGAGTGACTGGGG - Intergenic
902706511 1:18209006-18209028 GGGGGTGAAGGTAGTGACTGGGG + Intronic
903743972 1:25574338-25574360 CAGGGGCAATGCAGAGACTGAGG + Intergenic
903975202 1:27145244-27145266 GAGGGAGCAAGCAGTCCCTGAGG - Intronic
904730419 1:32586716-32586738 TAGCTAGAATGCAGTGAGTGAGG + Intronic
904855597 1:33495895-33495917 AAGGGAGAATGTTGTGACTCTGG + Exonic
905740221 1:40363791-40363813 GAAGGAGAGTGCAGTGATTGTGG + Intronic
906827173 1:48993805-48993827 GAGGGAGAGTGCAGTGATTGTGG - Intronic
907332493 1:53680106-53680128 GAGGGAGAAGGCAGGGAGGGAGG + Intronic
907388241 1:54139677-54139699 GAAGGAGACTGCAAAGACTGAGG + Exonic
907413687 1:54299683-54299705 GATGGAGAAGGCAGACACTGGGG - Intronic
908002715 1:59696512-59696534 GAGGAAGAAAGCATTTACTGGGG - Intronic
908093019 1:60706647-60706669 GAGGGAAAGTGAAGTGACTGTGG + Intergenic
908363274 1:63390801-63390823 GAGGGAGAGTGCAGTGACTATGG - Intronic
908397694 1:63741213-63741235 GAGGGAGAGCACAGTGATTGTGG - Intergenic
908460064 1:64340472-64340494 GAGGGAGAACGCTGTAATTGAGG - Intergenic
908508688 1:64832277-64832299 GAGAGAGAAAGCAGAGAGTGAGG - Exonic
909582461 1:77253466-77253488 GAGGGAGAGTGAAGTGATTGTGG + Intergenic
909848911 1:80434819-80434841 GAGGGAGATCTCAGTGACTGGGG - Intergenic
910470526 1:87547746-87547768 GAGGGAGAGGACAGTGACTGTGG - Intergenic
910716509 1:90236756-90236778 GAGAGAGAGTGCAGTGGCTGGGG - Intergenic
910724844 1:90327792-90327814 GAGGGAGAATGCAGTGATTGTGG + Intergenic
910885501 1:91959282-91959304 GAGGGAGGTTACAGTGACAGGGG + Intronic
911011607 1:93287183-93287205 GAAGGAGAATGCAGTGATTCTGG + Intergenic
911187287 1:94916395-94916417 GAGGGGGATTGCAGGGAGTGGGG + Intronic
911344101 1:96675128-96675150 GAGGGAGAGCACAGTGATTGTGG - Intergenic
911942860 1:104069514-104069536 AAGAGAGAGTGCAATGACTGGGG - Intergenic
912018549 1:105072981-105073003 AAGGAAGAGTGCAGTGACTGAGG - Intergenic
912134249 1:106640015-106640037 GAGGGAAAAAGGAGGGACTGAGG + Intergenic
912152643 1:106879442-106879464 GAGGGAGAGTGCAGCAACTTGGG + Intergenic
912316310 1:108670253-108670275 GTGGGAGAGCACAGTGACTGGGG + Intergenic
912873242 1:113328864-113328886 GAGGGAGAATGCAGTAATTGTGG - Intergenic
914425725 1:147573875-147573897 GTGGCATAATGCAGTGACAGTGG - Intronic
914454097 1:147819336-147819358 CAGGGAGTATGGAGTAACTGGGG + Intergenic
915005228 1:152629470-152629492 GAAAGAGAGTGCAGTGATTGTGG + Intergenic
915752661 1:158226760-158226782 AAGGGAGAGTGCAGTGATTGTGG + Intergenic
916500329 1:165381492-165381514 GAGAGAGGATGCATAGACTGGGG - Intergenic
917169556 1:172155912-172155934 GCAGTAGAGTGCAGTGACTGAGG + Intronic
917306126 1:173627466-173627488 GAGGGAGAGCACAGTGACTGTGG + Intronic
917373211 1:174317942-174317964 GAGGGAGAACACAGCAACTGTGG - Intronic
917397038 1:174604347-174604369 GAGGGAGAGGACAGTGATTGTGG - Intronic
918357891 1:183723504-183723526 GAGGGAGAGTACAGTGACTGTGG + Intronic
918515452 1:185358363-185358385 GAGGGAGGATGCAGACCCTGGGG + Intergenic
918683787 1:187389521-187389543 CAAGGAGAATGCAGTGGCTTTGG + Intergenic
919047385 1:192470422-192470444 GAGGGAAAGTGAAGTGATTGTGG - Intergenic
919067664 1:192713885-192713907 GAGGGAGAATGCATTGAGTGTGG + Intergenic
920182765 1:204142755-204142777 GAAAGAGTATTCAGTGACTGAGG + Intronic
920596828 1:207280193-207280215 GAGGGAGAGCACAGTTACTGTGG - Intergenic
920602292 1:207340096-207340118 GAGGGAGGATGAAGAGACTTTGG - Intronic
921002140 1:211055232-211055254 GAGAGAGAATCCAGGGACTTAGG + Intronic
921746122 1:218742678-218742700 GAGAGAGAGTGCAGTGATTGTGG + Intergenic
922044187 1:221927878-221927900 GAGAGAGAATGCAGTGATTATGG + Intergenic
922377031 1:224979325-224979347 GAGGGAGAGTGCAGTGCTTGTGG + Intronic
922388660 1:225114777-225114799 GAGAGAGAGCACAGTGACTGTGG - Intronic
924250900 1:242132172-242132194 CAAAGAGAATGCAGTGATTGCGG + Intronic
924490927 1:244536563-244536585 GAGACAGAGTGCAGTGATTGTGG - Intronic
924516320 1:244769012-244769034 GAGGGAGAGCGCAGTGACTGGGG - Intergenic
1063083511 10:2791198-2791220 GAGGGCGAATGAAGTGATAGGGG + Intergenic
1064521725 10:16209893-16209915 GAGGAAGAGCACAGTGACTGGGG - Intergenic
1064987631 10:21226676-21226698 GAGGGAGAGTAAAGTGATTGTGG - Intergenic
1065105703 10:22381631-22381653 GAGAGAGGTTGCAGTCACTGGGG + Intronic
1065431560 10:25662056-25662078 GAAGGAGAGTGTAGTGACTGTGG - Intergenic
1065818436 10:29503223-29503245 GAGGGTGTATGCAGTGACGAGGG - Intronic
1066046215 10:31597793-31597815 AAGTGACATTGCAGTGACTGAGG + Intergenic
1066395608 10:35018390-35018412 GAGGGAAAATGCAGTCTCTGGGG - Intronic
1066649839 10:37643671-37643693 GAAGGAGAGTGCAGTGATTATGG - Intergenic
1066780715 10:38942551-38942573 GTGGGAGAAAGCAGTGGCGGTGG - Intergenic
1067032729 10:42889218-42889240 GAAGGAGAGTGCAGTGATTATGG - Intergenic
1067074993 10:43173063-43173085 GAGGGAGAATGGATTGTGTGTGG + Intronic
1067706336 10:48609189-48609211 CAGGGAGTCTACAGTGACTGGGG - Intronic
1068124900 10:52827523-52827545 GAGGGAGAGCAAAGTGACTGTGG + Intergenic
1068148230 10:53098420-53098442 GCAGGAGAATGTAGTGAGTGAGG - Intergenic
1069050570 10:63788304-63788326 GAGGGAGAGCACAGTGACTGGGG + Intergenic
1069075066 10:64030687-64030709 GAGGGAGAACCCAATGACTCTGG + Intergenic
1069193571 10:65520303-65520325 GAGGGAGAGAGCAGTGATAGTGG - Intergenic
1069680307 10:70279880-70279902 GGGGGAGAATGGAGTGATGGTGG - Intronic
1070059557 10:72968676-72968698 GAGGGAAAGTACAGTAACTGGGG - Intergenic
1071129735 10:82376801-82376823 GAGGGAGAATGAAAAGAGTGAGG - Intronic
1071586949 10:86832572-86832594 GAGGTAGAAGGCAGTGATTGTGG - Intronic
1071757149 10:88555815-88555837 GAGGGAGATGCCAGTGAGTGAGG - Intronic
1071931558 10:90477389-90477411 AAGTGAGAATGCAGTGTGTGGGG + Intergenic
1072029038 10:91499337-91499359 GAGAGAAAATGAACTGACTGGGG - Intronic
1072344422 10:94489312-94489334 GAGGAACAACACAGTGACTGAGG - Intronic
1072492501 10:95921318-95921340 GAGGGAGAGTTAAGTGATTGGGG - Intronic
1072844399 10:98813485-98813507 GATGGAGAAGGCAGTGATTTTGG - Intronic
1073057079 10:100709845-100709867 ACTGGAGAATGCAGTGCCTGAGG - Intergenic
1073827213 10:107337479-107337501 GAGGGAGATCACAGTGACTGGGG - Intergenic
1074302282 10:112243240-112243262 GAGGGAGAATGCAGTGATTGTGG - Intergenic
1074670050 10:115780153-115780175 GAGGGAGAGCACAGTGATTGTGG + Intronic
1074952779 10:118355822-118355844 GAGGAAGAAAGGAGTTACTGAGG + Intergenic
1075496260 10:122922165-122922187 GAGGGAGAGTGCAGTGATTGTGG + Intergenic
1075688195 10:124378358-124378380 GAGGGAGAATGCAGTGAGGAGGG + Intergenic
1076474464 10:130742772-130742794 GAGGGAGATTGCAGATCCTGTGG + Intergenic
1076709127 10:132321492-132321514 GAGGGTGAATGAAGTGGCTCTGG - Intronic
1077840441 11:5968444-5968466 GAGGAAGAATTCAAAGACTGGGG + Exonic
1077843822 11:6002942-6002964 GAGGAGGAATTCAGAGACTGGGG + Exonic
1078265868 11:9756056-9756078 GAGGGAAAATGCAGAAAGTGGGG - Intergenic
1078563172 11:12390663-12390685 GTGGGAGAATGGAGTGAGGGAGG - Intronic
1078690782 11:13578734-13578756 GAGGGAGAGTGCAGGGATTGCGG + Intergenic
1079416300 11:20239183-20239205 GAAGGAGAGCACAGTGACTGGGG - Intergenic
1080307073 11:30848286-30848308 GAAGAAGAATGAAGTGACAGAGG - Intronic
1080966641 11:37220568-37220590 GAGAGAGAATGCAGTGATCGTGG - Intergenic
1081202096 11:40229044-40229066 GAGGGAAAAAGCAGTCACTTGGG + Intronic
1081522160 11:43892884-43892906 CAGGGAGAAAACATTGACTGAGG + Intronic
1081868451 11:46372345-46372367 GAGGGAGAGGGGTGTGACTGTGG - Intronic
1081884664 11:46484739-46484761 GAGGGAGAATGATGTGAATCCGG - Intronic
1082012527 11:47459800-47459822 GAGGACGAATGCAGTGGCTGTGG + Intergenic
1083404564 11:62447656-62447678 GAGGGAGGAGGCAGTAACCGAGG - Intronic
1083923136 11:65791119-65791141 GAGGGAAAATACACTGTCTGAGG + Intronic
1084537967 11:69768931-69768953 GAGGGAGATGACAGTGAATGAGG - Intergenic
1084763961 11:71295402-71295424 GAGGTATAATGCAGTGATTGTGG - Intergenic
1085194852 11:74662958-74662980 GAGGGAGAGTGCAGCAACTGTGG - Intronic
1085473288 11:76771767-76771789 GAGGGAGAATGCTTTGACTAAGG - Intergenic
1085572245 11:77569532-77569554 GAGGGAGAGTGCAGTGATTATGG - Intronic
1086332452 11:85767722-85767744 GAGGGAGGATGAAGAGACTTGGG - Intronic
1087358120 11:97121379-97121401 GCAGGAGAATGGCGTGACTGCGG + Intergenic
1087950928 11:104219541-104219563 GAGGGAGAACACAATGCCTGTGG - Intergenic
1088889590 11:114033968-114033990 GAGGGAGGGTGCAGGGCCTGGGG + Intergenic
1089618168 11:119706966-119706988 GAGGGAGAATTGAGGGACAGGGG - Intronic
1089998543 11:122932006-122932028 CATGGAGTATGCAGCGACTGCGG + Intronic
1090210493 11:124917567-124917589 GAGGGAGAGTGCAGTCATTGTGG - Intergenic
1090786281 11:130050553-130050575 GAGGGAGCAGGCAGTCACTAGGG + Intergenic
1091275963 11:134350426-134350448 AAGGGAGAGCACAGTGACTGGGG - Intronic
1091399300 12:172828-172850 GAGGAAGGATCCAGAGACTGCGG + Intronic
1092033165 12:5306782-5306804 GAGACAGAATACATTGACTGGGG + Intergenic
1092051331 12:5472750-5472772 GAGGGAGAAAGCTGTGGCAGAGG + Intronic
1092232212 12:6782533-6782555 GAGGGAGACAGGAGTCACTGGGG + Intergenic
1092477142 12:8828951-8828973 GCGGGAGAGCACAGTGACTGTGG - Intronic
1093321383 12:17719090-17719112 GAGAGAGAGCCCAGTGACTGTGG - Intergenic
1093531901 12:20175253-20175275 GAGAGAGAGTCCAGTGACTGTGG - Intergenic
1093931625 12:24960328-24960350 GAGGAAGAGCACAGTGACTGTGG + Intergenic
1094655924 12:32419458-32419480 GAGGGAGAATGCAGTGACTGGGG - Intronic
1095163212 12:38941087-38941109 GAGGAAGAGCACAGTGACTGTGG + Intergenic
1095860140 12:46907801-46907823 AAGGGAGAGTGCAGTGACTGTGG + Intergenic
1096770375 12:53932427-53932449 GAGGGAGGAGGCAGTGAGGGAGG + Intergenic
1096845411 12:54403854-54403876 GACAGAGAATGAAGGGACTGGGG - Intronic
1096886189 12:54721451-54721473 GAAGAAGAAGGCAGCGACTGAGG - Intergenic
1097254089 12:57659038-57659060 GAGAGAGAAAGCATTGCCTGTGG - Intergenic
1097508516 12:60506932-60506954 GAGGAAGAACGCAGCGGCTGGGG + Intergenic
1097569095 12:61308722-61308744 GTGGGAGAGCGCAGTGACTGAGG - Intergenic
1097714860 12:62955207-62955229 GATGTAGAGTGCAGTGACTAAGG - Intergenic
1099101012 12:78440095-78440117 GAGGGAGAGCAAAGTGACTGTGG - Intergenic
1099119113 12:78665606-78665628 GAGGGAGAGTGCAGCAACCGGGG - Intergenic
1099237728 12:80102107-80102129 GATGCAGAATGCAGTGGTTGAGG + Intergenic
1099491304 12:83292059-83292081 AAGGGAGAGTGTAGTGATTGTGG + Intergenic
1099757786 12:86876892-86876914 GAGGGAGAGCGCAGTGACTGTGG - Intergenic
1099974305 12:89530316-89530338 GAGGCAGAAGGCAGGGTCTGTGG - Intergenic
1100946300 12:99787818-99787840 AAGGGAGAAAGCAGTGACTGAGG + Intronic
1102734010 12:115141235-115141257 GAGGGAGAAAGCTGGGCCTGTGG + Intergenic
1103048927 12:117762321-117762343 GAGGAAGTATGCGGTGGCTGAGG - Intronic
1104226408 12:126838503-126838525 AAGGGTGAATGAAGGGACTGGGG - Intergenic
1105348287 13:19593704-19593726 GAGGGAGAAGGCACTAGCTGAGG - Intergenic
1105444121 13:20437725-20437747 GAGGGAGAAGAAAGTGACTCAGG + Intronic
1105982889 13:25536878-25536900 TAAGGTGAATGCAGTGACTAAGG - Intronic
1106007236 13:25782433-25782455 CAGGCAGAATGCTGAGACTGAGG + Intronic
1106298262 13:28438437-28438459 AAGGGAGAATGACGTGACTGTGG - Intronic
1106350214 13:28922632-28922654 GAGGGAGAGCGCAATGACTGGGG - Intronic
1106519862 13:30487112-30487134 GTGTGAGAATGCAGTGAATGTGG + Intronic
1107677334 13:42810925-42810947 GAGGGAGCACACAGTGAGTGGGG + Intergenic
1107753948 13:43599325-43599347 GAGGGAGAGTGCAGCGATGGTGG - Intronic
1107753959 13:43599366-43599388 AAGGGAGAGTGCAGTGATAGTGG + Intronic
1107808347 13:44175548-44175570 GAGGGAGAGTGCAGTGATTGTGG - Intergenic
1109211363 13:59538963-59538985 GAGGGAAAGCGCAGTGACTGGGG - Intergenic
1109566902 13:64130420-64130442 GAAGGAGAATGCAGCAACTGGGG + Intergenic
1110079047 13:71287474-71287496 GAGAGAAAGCGCAGTGACTGTGG - Intergenic
1110557211 13:76873609-76873631 GAGGAAGAATGGAGTTACTGAGG - Intergenic
1110665875 13:78116771-78116793 GAGGGAGAATGCAGTGACTGTGG - Intergenic
1110972946 13:81789513-81789535 GAGGGAGAAAGAAGTGAGGGAGG - Intergenic
1111255637 13:85663763-85663785 AAGAGAGATTGCAGTGACGGGGG - Intergenic
1111301587 13:86357548-86357570 GAGAGATAATTTAGTGACTGGGG + Intergenic
1111329803 13:86750122-86750144 GAGAGAGAATGCAGTCCCTCGGG + Intergenic
1111335458 13:86815764-86815786 AAGGGAGAGTGCTGTGATTGTGG + Intergenic
1111583451 13:90253743-90253765 CAGGGAGAGTGAAGTGAGTGTGG - Intergenic
1112944500 13:104910749-104910771 GAGGGAGAGCACAGTGACTGGGG - Intergenic
1113263813 13:108594320-108594342 GAGGGAGAATGCAGGCAGTGAGG - Intergenic
1113337835 13:109393888-109393910 AGGGGAGAATGCAGAGGCTGTGG - Intergenic
1113523948 13:110959281-110959303 GAGAGAGAAAGCAGTGCCTGTGG - Intergenic
1113639519 13:111947190-111947212 GAGGGTGCAGGCAGAGACTGGGG + Intergenic
1113834288 13:113318745-113318767 GAGGGAGAAGGCAGTGAGTGTGG - Intronic
1114194733 14:20467504-20467526 GAGGTGGCATGGAGTGACTGGGG + Intergenic
1114702591 14:24694016-24694038 TAGAGAAAATGCATTGACTGCGG + Intergenic
1114901882 14:27071581-27071603 GTGGGATAATGGAGGGACTGGGG + Intergenic
1115133882 14:30086205-30086227 GAGGGAGAGCACAGTGACTGGGG + Intronic
1116114875 14:40635388-40635410 GAGAGAGAATGTAGTGATTGTGG + Intergenic
1116124981 14:40772612-40772634 GTTGTAGAATACAGTGACTGTGG + Intergenic
1116275724 14:42828431-42828453 GAGGGAGACCACAGTGATTGTGG - Intergenic
1117161618 14:52995342-52995364 GAGGGAGAGCACAGTGACTATGG - Intergenic
1117208997 14:53476110-53476132 GTGGGAGAAGGCTGTGACTCAGG - Intergenic
1117233874 14:53751575-53751597 GACGGATGGTGCAGTGACTGGGG + Intergenic
1117464008 14:55974356-55974378 GCAGGAGAATGCAGAGAATGTGG + Intergenic
1117870656 14:60197451-60197473 GAGGGAGGACAAAGTGACTGTGG + Intergenic
1118114666 14:62761880-62761902 GAGGGAGGATGCAGACCCTGGGG + Intronic
1118662463 14:68029046-68029068 GAGGGTTAATGAAGAGACTGTGG - Intronic
1118959285 14:70514086-70514108 CAGGAAGAATGCAGAGACTGGGG - Intergenic
1120775390 14:88430229-88430251 GAGGGAGAAGCCAGAGCCTGAGG - Intronic
1121225241 14:92316988-92317010 CAGTGAGAATGCCGTTACTGTGG - Intergenic
1122112946 14:99514553-99514575 GGGGGACATTGCAGAGACTGGGG + Exonic
1125492397 15:40158062-40158084 GCAGGAGAATGGAGTGTCTGTGG - Intergenic
1125519645 15:40340682-40340704 GAGGAAGAAGGCTGTGACTAGGG - Intronic
1126452454 15:48823567-48823589 GAGGGAGAATGCAGTGCCTTGGG - Intergenic
1126463714 15:48940722-48940744 GAGGGAGAATGACGTCAATGAGG - Intronic
1126489146 15:49216809-49216831 GAGGGAGGGTGAAGTGAGTGTGG - Intronic
1126660830 15:51031471-51031493 GAGAGGGACTGCAGTGATTGTGG - Intergenic
1127304220 15:57686250-57686272 GAGAGAGAAAGAAGTGAATGTGG - Intronic
1127493202 15:59484557-59484579 GAGGGAGAGTGCAGTGTTTATGG + Intronic
1127971647 15:63966734-63966756 GAGGGAGAGTGCAGCAATTGTGG - Intronic
1128926714 15:71662945-71662967 GAGGGAAAATGGAGTCAGTGAGG + Intronic
1129030752 15:72616018-72616040 GAGGGAGAATGCAGCAACTGTGG - Intergenic
1129477595 15:75796542-75796564 GAGGGAGAATACAGCAACTGTGG - Intergenic
1129835662 15:78703819-78703841 GAGGGAGAATGCAGCAACTGTGG - Intronic
1129972470 15:79790930-79790952 GGGGGAGGATGCAGAGACAGTGG - Intergenic
1130384743 15:83401228-83401250 GAGGAAGAAGGCAGTGGCTATGG - Intergenic
1130511673 15:84594817-84594839 GAGGGAGAATGCAGCAACTGTGG + Intergenic
1131095197 15:89650049-89650071 GATGGAGAAGGCAGTGGCCGAGG + Intronic
1131944799 15:97608396-97608418 GAAGGAAAGTGCAGTGATTGTGG + Intergenic
1131960701 15:97787573-97787595 CACGGAGAATGCAGAGAGTGAGG + Intergenic
1132377602 15:101340542-101340564 GAGGTAGAATGGAGTGAAGGAGG - Intronic
1133130747 16:3674848-3674870 GAGGGGGAAGTCAGTCACTGAGG + Intronic
1134364017 16:13560036-13560058 GAGAGAGAATTCATTGACTTGGG + Intergenic
1134796166 16:17038964-17038986 GAAGGAGAATGTAGTGCATGTGG - Intergenic
1135176273 16:20232436-20232458 GAAGGAGAATTCATTGACTCAGG - Intergenic
1135332731 16:21574224-21574246 GAGTGGGAAAGCAGGGACTGAGG + Intergenic
1136679123 16:31945056-31945078 GAGGGAGATTGCAGCAACTGGGG + Intergenic
1138110137 16:54317298-54317320 GAGGGAGAATGGAGGGGCCGCGG - Intergenic
1138391799 16:56675816-56675838 GAGGGAGAATGGAGGGGGTGGGG + Intronic
1138845059 16:60554981-60555003 GAGGGAGAGTGCAGTGATAGGGG - Intergenic
1138890837 16:61142467-61142489 GAGGGAGAGTGCAGAGATTGTGG - Intergenic
1139005042 16:62559488-62559510 GAGGGAGAGTGCAGTGACTGTGG - Intergenic
1139961812 16:70722257-70722279 AAGGGAGCATGCAGTGCCCGGGG - Intronic
1140688928 16:77462779-77462801 GTGGGAGAATGCAGTGTGTTTGG + Intergenic
1141376603 16:83536489-83536511 CAGTGGGAATGCAGTGAGTGTGG + Intronic
1141485007 16:84333166-84333188 GAGGAAGACTGCAGCCACTGGGG + Intergenic
1142132282 16:88436540-88436562 GAGAGAGAACGCTGTGACGGTGG + Exonic
1142919138 17:3169344-3169366 GAGAGAGAATGCAGTGAGTGTGG + Intergenic
1142986774 17:3700115-3700137 GAGATAGAATGCAGATACTGGGG - Intergenic
1143413584 17:6728428-6728450 GAGGGAGAGTAGAGTGATTGTGG + Intergenic
1143710299 17:8729884-8729906 GGGGAAGAGTGCAGTGACGGGGG - Intergenic
1144021873 17:11245104-11245126 GAGTGAGAAATCAGTGTCTGTGG + Intronic
1144090618 17:11852660-11852682 CAGGGAGAATGCAATGAGTTGGG + Intronic
1144731375 17:17528295-17528317 GAGTGAGAAGGCACTGGCTGCGG - Intronic
1144859537 17:18292228-18292250 GTGGGAAACTGCAGTGACAGGGG + Intronic
1144862445 17:18314131-18314153 GCTGTAGAATGCAGTGGCTGTGG + Intronic
1145689916 17:26729263-26729285 GAGGGTGCATGTAGTGCCTGGGG - Intergenic
1145899995 17:28484413-28484435 GAGGGAGGATGCAGTATTTGAGG + Intronic
1146098966 17:29960134-29960156 CAGGGAGAGCACAGTGACTGTGG - Intronic
1147608159 17:41785883-41785905 GAGGTGGGATGGAGTGACTGGGG - Intronic
1147661232 17:42118145-42118167 GAGAGAGAAGGCAGGGACTGGGG + Intronic
1148124851 17:45231315-45231337 GAGGGAGGCTGCAGAGGCTGGGG + Intronic
1148161857 17:45454668-45454690 AAGGAAGAAAGCAGTGACAGAGG - Intronic
1149249346 17:54750034-54750056 ATGGGAGAGTGCAGTGATTGTGG - Intergenic
1149466430 17:56883549-56883571 CAAGGAGAATGAAGAGACTGAGG + Intergenic
1150336975 17:64337439-64337461 CAGGGATAATACAGTGACTGTGG + Intronic
1150567072 17:66351145-66351167 GAGTGGGTATGCAGTGAATGTGG + Intronic
1152070284 17:78130871-78130893 GAGGGAGAATGCAGAGGGTGAGG + Intronic
1152685127 17:81690145-81690167 GTGGGAGCAGGCAGTGACTATGG + Intronic
1152891970 17:82887300-82887322 GAGGGAAACAGCAGGGACTGTGG - Intronic
1153356708 18:4144414-4144436 GAGGGAGAACACAGTGATTGTGG - Intronic
1153429353 18:4999139-4999161 GAGGGAGAGTGCAGTGACTGAGG + Intergenic
1153765369 18:8369555-8369577 CAGGAAGAGCGCAGTGACTGTGG + Intronic
1155117545 18:22784192-22784214 GCAGGAGAATGCAGTGATGGTGG + Intergenic
1155267246 18:24106019-24106041 GAGGGAGAATGCAGATGCGGAGG - Intronic
1155443291 18:25884415-25884437 GAGGGAGAGCACAGTGATTGTGG + Intergenic
1155767348 18:29652368-29652390 GAGGGAGAATGCAGTGAATGTGG + Intergenic
1156274414 18:35569505-35569527 GATGGAGAATTCAGTGACTCTGG - Intergenic
1157630861 18:49093675-49093697 GAGGCAGAAGAGAGTGACTGTGG + Intronic
1157879196 18:51304112-51304134 GAAGGAGAGTGCAGTGATTGTGG + Intergenic
1158225112 18:55192744-55192766 GAAGGAGATTAAAGTGACTGAGG + Intergenic
1159080517 18:63730757-63730779 GAGGGAGAGTGCAGCAACTTGGG + Intergenic
1159564855 18:70036978-70037000 GAGGGAGAGAGCAGCGACTGGGG + Intronic
1159794958 18:72830733-72830755 GAGGGAAAATGCAGTCAAAGTGG - Intronic
1162098116 19:8322861-8322883 GAAGGAGAATGCGGTGACAATGG - Exonic
1162185256 19:8899985-8900007 GAGGGAGGATGGAGTCCCTGAGG + Exonic
1162185680 19:8903182-8903204 GAGGGAGGATGGAGTCCCTGAGG + Exonic
1162186411 19:8908612-8908634 GAGGGAGAATGGAGTCCCTGAGG + Exonic
1162186977 19:8913471-8913493 GAGGGAGGATGGAGTCCCTGAGG + Exonic
1162596030 19:11629986-11630008 GAGGGAGAGCGCAGTGATTGTGG + Intergenic
1163480099 19:17550191-17550213 AAGGGAGATTGTAGTGACAGGGG + Intronic
1164019829 19:21290778-21290800 GAAGGAGAATGGCGTGAATGTGG + Intronic
1164091761 19:21959604-21959626 GGGGGAAAATAAAGTGACTGCGG + Intronic
1164111505 19:22163907-22163929 GAGTGAAAATAAAGTGACTGCGG + Intergenic
1164123221 19:22286711-22286733 GATGGCGAATGCGCTGACTGCGG + Intronic
1164195965 19:22959325-22959347 GAGTGAAAATAAAGTGACTGCGG + Intergenic
1165785506 19:38459400-38459422 GGGGGACCATGGAGTGACTGGGG - Intronic
1166746249 19:45143220-45143242 GAGGGAGACAGTGGTGACTGTGG + Intronic
1167315252 19:48759025-48759047 GAGGCAGAATGGCGTGAATGCGG + Intergenic
1167470078 19:49670700-49670722 GAGCGTGAAACCAGTGACTGAGG + Intronic
1168135647 19:54349473-54349495 GAGGGAGGATGCAGATCCTGAGG + Intergenic
1168448960 19:56448177-56448199 GAGGAAGAATGGAGTGATGGTGG + Intronic
925377667 2:3399916-3399938 CTGGGAGCACGCAGTGACTGAGG - Intronic
925491270 2:4395889-4395911 GAGGGAGAATAAAGTAAATGTGG - Intergenic
925588469 2:5486941-5486963 GAGAGAGAGTGCAGTGATTATGG + Intergenic
925699060 2:6614371-6614393 GACGGAGAGTGCTGTGAGTGTGG - Intergenic
925868274 2:8247592-8247614 GAGTCAGAATGCAATGAATGTGG - Intergenic
926210023 2:10862699-10862721 GTGGGAGGATAGAGTGACTGTGG + Intergenic
926518749 2:13883411-13883433 GAGGGAGAGCACAGTGATTGCGG + Intergenic
927243735 2:20940463-20940485 GAGGGAAAATGCAGGGATTACGG + Intergenic
927370189 2:22345519-22345541 GAGGGAGAATGTAGTGATAGAGG - Intergenic
928026189 2:27741253-27741275 GAGGGAGACTGCAGGGAGGGAGG - Intergenic
928091920 2:28379907-28379929 CAGGGAAAATGCAGAGACTCCGG + Intergenic
928605979 2:32946061-32946083 GAGGAAGACTGCTATGACTGTGG + Intergenic
928847611 2:35696690-35696712 GAGGGAGAGCAAAGTGACTGGGG - Intergenic
929099877 2:38301575-38301597 GAAGTCGAAAGCAGTGACTGTGG + Intronic
929281838 2:40088204-40088226 GAAGGAAAGTGCAGTGACTGTGG - Intergenic
930288944 2:49468770-49468792 GAGGGAGAGCACAGTGATTGTGG - Intergenic
930439785 2:51391221-51391243 GAGGGAGAGTACAGTGACTGGGG - Intergenic
930469156 2:51791841-51791863 GAGAGAGAGTGTAGTGATTGTGG + Intergenic
930865917 2:56121721-56121743 AAGGGAGGAGGCAGTTACTGTGG + Intergenic
930981272 2:57528780-57528802 GAGGGAGAGTTAAGTGATTGTGG - Intergenic
931407013 2:61988946-61988968 GAGGGAGAGTGCAGCAATTGTGG - Intronic
932517455 2:72367731-72367753 GAGGGAGAGTGCAGCAACTGGGG + Intronic
932889378 2:75579002-75579024 GAGAGAAAGTGCAGTGATTGTGG + Intergenic
933086612 2:78061242-78061264 GAGGGACAGTGAAGTGAGTGTGG + Intergenic
933156604 2:78982343-78982365 GAAAGATAATGCAGTGACTAAGG + Intergenic
933351544 2:81158733-81158755 AATGGAGAGAGCAGTGACTGCGG + Intergenic
933480834 2:82855085-82855107 CAGAGAGACTGGAGTGACTGCGG + Intergenic
934119916 2:88828807-88828829 GAGCCAGGATGCAGTGACTCAGG - Intergenic
934711259 2:96515797-96515819 GAGGGAGAATGAGGGGGCTGGGG - Intergenic
934928861 2:98404044-98404066 TGGGGAGAGTGCAGTGATTGTGG + Intergenic
935018946 2:99212133-99212155 GAGGGAGAATGAAGTGATCATGG - Intronic
935437955 2:103056899-103056921 GAGGGAGAGTGCCGTGACTAGGG - Intergenic
935835672 2:107050631-107050653 GATGGAGAGTGCAGCCACTGGGG - Intergenic
936237168 2:110752524-110752546 GAGAGAGAAAGTAGTGATTGAGG + Intronic
936703806 2:115045581-115045603 GAGGGTGAGTGCAGTGATTGCGG - Intronic
936940505 2:117879298-117879320 GAGGGAAAGTGCAGTGATTGTGG - Intergenic
937193958 2:120133442-120133464 GAGGGAGAGCACAGTGACTATGG + Intronic
937331017 2:121030015-121030037 GATGGAGAATGCAGTGGGTGGGG + Intergenic
937488575 2:122341647-122341669 GAGAGAGCAAGCAGTGTCTGAGG + Intergenic
937613671 2:123893906-123893928 GAGGGAGAGTGCAGATACTGGGG - Intergenic
938587635 2:132707206-132707228 GGGGGAAAGTGCAGTGACTGTGG + Intronic
938986313 2:136579801-136579823 CAGGGAGAAGGCAGTGGCTGGGG + Intergenic
939019143 2:136938327-136938349 GAGGTAGAACCCAGAGACTGAGG + Intronic
939144422 2:138395702-138395724 GAGAGAGACTGCAGTGACTGTGG + Intergenic
939273495 2:139970322-139970344 GAGGGAGAGCACAGAGACTGGGG + Intergenic
939412391 2:141845542-141845564 TAGGGGGACTGCAGTGTCTGAGG + Intronic
939708028 2:145479186-145479208 GAGGAAGACTGCAGTGACTAAGG - Intergenic
940402668 2:153265476-153265498 GAGAGAGAATGCAGTGGTTGTGG - Intergenic
941461655 2:165779207-165779229 GAGGGACACTGAAGTGGCTGAGG - Intronic
941742137 2:169046598-169046620 GAGGGAGAGCACAGTGACTGTGG + Intergenic
941746095 2:169088293-169088315 GAGGGAGAGCACAGTGATTGTGG - Intronic
941851925 2:170191633-170191655 GAGGGAGAGCACAGTGATTGGGG - Intronic
941907797 2:170733879-170733901 GAGGGAGAAAGCCCTGACTTTGG - Intergenic
942881795 2:180870664-180870686 GAGGGAGAGTGCAGTGACTGTGG + Intergenic
943099657 2:183472224-183472246 GAGGGAGAGTGCAGTGACTATGG - Intergenic
943192997 2:184704779-184704801 GAGGGACAATGCATTGACACTGG + Intronic
943844981 2:192634469-192634491 GAGGGAGAGTACAGTGATTCTGG + Intergenic
943867048 2:192938492-192938514 AAGGGAGAGTGCAGTGACTGAGG - Intergenic
943913009 2:193592440-193592462 GAGGGAGAGGACCGTGACTGGGG + Intergenic
944096051 2:195968932-195968954 GAGGGACAGCGTAGTGACTGGGG - Intronic
944133380 2:196370829-196370851 GAGGGAGAATGCAGTGATTGTGG - Intronic
944616549 2:201465910-201465932 GAGGGAGAGTGCAGTGATTGTGG - Intronic
944760239 2:202807309-202807331 GAGGGAGAGTGCAGTGATTGTGG + Intronic
944978963 2:205092078-205092100 GAGGGAGAAGGTACTGAGTGAGG + Intronic
945334322 2:208573490-208573512 GAGGTAGAGTGAAGTGATTGTGG + Intronic
945921160 2:215756046-215756068 GAGGGAGAATGAAGAGAGAGGGG - Intergenic
946107625 2:217385847-217385869 GAGGGAAAATGAAGTCACTTAGG + Intronic
947131031 2:226924808-226924830 GAGGGAGAGCACAGTGATTGTGG - Intronic
947855105 2:233318717-233318739 GAGGGAGAGAGCAGTGAGGGTGG - Intronic
948774554 2:240277080-240277102 GAGGGAGAGAGCAGTGACTGTGG + Intergenic
1168748202 20:263169-263191 GAGGGAGAGCACAGTGATTGTGG + Intergenic
1169988612 20:11474247-11474269 GAGGGAGAGCACAGTGATTGTGG + Intergenic
1170668265 20:18405885-18405907 GAGGGAGAGCACAGTGACTGGGG + Intronic
1170709363 20:18776128-18776150 GAGGGAGAGTGCAGTGATTATGG - Intergenic
1170864222 20:20138509-20138531 GAGAGAAAGTGCAGTGACTGTGG - Intronic
1171945633 20:31374967-31374989 GGGAGAGAAGGCAGTGACTAGGG - Intergenic
1172215476 20:33232741-33232763 CAGGGAGCATGCAGTCCCTGTGG + Intergenic
1172841263 20:37903745-37903767 GTGTGAGAAAGCAGCGACTGTGG - Intronic
1173004942 20:39133071-39133093 GAAGGTGAAAGCAGTGAGTGTGG + Intergenic
1173431358 20:42989676-42989698 GAGGGAGGAGGGAGTGGCTGGGG - Intronic
1173569595 20:44067756-44067778 GAGGGAGAGTGCAGTGAGGAGGG + Intronic
1173712533 20:45173267-45173289 GAAGGAGAATGAAGCAACTGAGG + Intergenic
1174427358 20:50441590-50441612 GAGGGAAAGTGCAAAGACTGTGG - Intergenic
1175984092 20:62755531-62755553 GAGGGAGAATGCATGGAGGGAGG - Intronic
1176940061 21:14912638-14912660 GAGGGAGAATGCATTGATTGTGG - Intergenic
1177105067 21:16945486-16945508 GAGGAAGAGTGCAGAGACCGTGG + Intergenic
1177167959 21:17624162-17624184 GAGGGAGAAAGCATGGGCTGGGG - Intergenic
1177295142 21:19163561-19163583 GAGAAAGAGTGCAGTGATTGTGG - Intergenic
1177760654 21:25399345-25399367 GAGGGAGAACAGAGTGACTGTGG + Intergenic
1177771194 21:25518564-25518586 GAGGGGGAGCACAGTGACTGTGG + Intergenic
1178733772 21:35130625-35130647 GAAGGAGAAAACAGTGCCTGGGG - Intronic
1179652381 21:42820034-42820056 GAGGGAAGGTGCAGTGATTGTGG + Intergenic
1179979949 21:44890654-44890676 GTGGGAGAATGCAGGGACAAGGG + Intronic
1180899356 22:19359433-19359455 GGTGGAGAATGAAGTGACAGTGG - Exonic
1181621972 22:24097467-24097489 TAGAAAGAATGAAGTGACTGGGG - Intronic
1182103960 22:27675692-27675714 GAGGAGCAATGGAGTGACTGGGG + Intergenic
1182201729 22:28578743-28578765 AAGGGAGAGTGCAGTTATTGTGG + Intronic
1182785275 22:32902299-32902321 AAGGGAGAATGTAGTCAGTGAGG + Intronic
1183012682 22:34959913-34959935 GAAGGAGGATGCAGTTTCTGGGG - Intergenic
1183756221 22:39768331-39768353 CAGGGAGAATGGCCTGACTGAGG - Intronic
1184345407 22:43909897-43909919 GAGGGAGAAGGGAGGGACAGAGG + Intergenic
1184421578 22:44385462-44385484 GAGGGGGAGTGCAGCCACTGTGG - Intergenic
1203325275 22_KI270738v1_random:8229-8251 GAGGGTGCATGCAGAGCCTGGGG + Intergenic
949829394 3:8197632-8197654 GAGGGAGAGCACAGTGACTGTGG - Intergenic
950144480 3:10639427-10639449 CAGTGAGAAGGCAGTGTCTGAGG - Intronic
950801198 3:15552975-15552997 GAGGGAGAGTGCCGTAACTGTGG - Intergenic
951029400 3:17864125-17864147 GAGGGAGAGCACAGTGACTGTGG - Intronic
951279668 3:20732347-20732369 AAGGGAGAGTGCAGAGATTGTGG - Intergenic
951688734 3:25373373-25373395 GAAGGAGAATGCAGTGAGTGAGG + Intronic
952066560 3:29577720-29577742 GAGGGAGAATACAGCAACTGGGG - Intronic
952132931 3:30385223-30385245 GAGGGAGAGTACAGCAACTGTGG - Intergenic
952688487 3:36176246-36176268 GAGGAAAAGTGCAGTGATTGTGG - Intergenic
952881373 3:37988037-37988059 GAGGGAGACTGCTGTGGCTAAGG + Exonic
952925304 3:38315657-38315679 GAGGAAGAACACAGTGACAGTGG - Exonic
952957447 3:38565836-38565858 CAGGGAGAAGGTACTGACTGGGG - Intronic
953335054 3:42087434-42087456 GAGGGAGGTTTCAGTCACTGAGG + Intronic
953362508 3:42310280-42310302 GAGGGAGAGCACAATGACTGGGG - Intergenic
953899495 3:46831707-46831729 AAGGGAGATTGCACTGCCTGGGG - Intronic
954429142 3:50459943-50459965 GAGGGTGGAAGCAGTGCCTGTGG - Intronic
954491479 3:50910710-50910732 GAGGGAGAACAAAGTGACTGTGG - Intronic
954521912 3:51235809-51235831 AATGGAGAATGCAGTCAATGAGG - Intronic
955585333 3:60471513-60471535 GAAGGAGAGTGCAGTGATTGTGG - Intronic
955682261 3:61514531-61514553 GAGGGACAATGCAGGGAAAGAGG + Intergenic
956222770 3:66922284-66922306 GAGGGAGAGTGCAGCAGCTGGGG + Intergenic
956830635 3:73044266-73044288 TAGGAACAATGCAGTCACTGTGG - Intronic
957018976 3:75102115-75102137 GAGGGAGAGTGCAGTGATTGTGG - Intergenic
957485588 3:80858412-80858434 GAGGGAGAGCACAGTGATTGAGG + Intergenic
957538099 3:81532021-81532043 GAGGGAAAACACAGTGACTGTGG - Intronic
957541817 3:81580734-81580756 GCAGGAGATTTCAGTGACTGAGG + Intronic
957907710 3:86578953-86578975 GAGGGAGAGCACAGTGACTGGGG - Intergenic
957965723 3:87320983-87321005 GAGGGAGAGTACAGTGATTGTGG + Intergenic
958147004 3:89639276-89639298 GAGAAAGAATACAGTGACTGTGG + Intergenic
958254114 3:91304974-91304996 GAGGGAGGATGAAGGGAGTGGGG - Intergenic
958682690 3:97352488-97352510 GAGAGAGAATGCAGTGACTGTGG + Intronic
958743162 3:98099316-98099338 GAGGGAAAATGTACTGTCTGTGG - Intergenic
958765987 3:98368336-98368358 GAGGGAGAGTGAAGTGATTGTGG - Intergenic
958839403 3:99185925-99185947 GAGGGAGAGTGCAGTGATTGTGG + Intergenic
959191071 3:103112398-103112420 GAGGGAGACTGCAGTGACTGGGG + Intergenic
959284963 3:104397182-104397204 GAGAGAGAGTGTAGTGACTGTGG + Intergenic
959448401 3:106468065-106468087 AATTGATAATGCAGTGACTGTGG - Intergenic
959716768 3:109442441-109442463 GAGGGAGACTGCAGCAATTGTGG + Intergenic
959806711 3:110562856-110562878 GAAGGAGAATGCAGTGATTGTGG - Intergenic
959882577 3:111461681-111461703 AAAGGAGAATGAAGTGACAGAGG + Intronic
959913842 3:111794298-111794320 GAGAGAGGGTGCAGTGACTGCGG - Intronic
959946101 3:112126737-112126759 GAGGCTGAAGGCAGTAACTGGGG - Intronic
960660152 3:120049287-120049309 GAGGGAATATTCAGTGAATGTGG + Intronic
960801624 3:121545908-121545930 GAGGGAGGACGCTGGGACTGTGG - Exonic
960815680 3:121669680-121669702 GAGGGAGAAGGCAGTACCTCAGG + Intronic
961569275 3:127786476-127786498 CAGGGAGAAGGCAATGACTGTGG + Intronic
962015045 3:131430947-131430969 GAGGGACAGGGCAGTGACTGTGG + Intergenic
962483213 3:135815811-135815833 GAGGGAGAATGCAGTGATCATGG + Intergenic
962505672 3:136044727-136044749 GAGAGATGATGCAGTCACTGAGG + Intronic
962767472 3:138579076-138579098 GAAGTAAAGTGCAGTGACTGTGG + Intronic
963154022 3:142077042-142077064 GAGGGAGAGCTCAGTGACTGTGG + Intronic
963170755 3:142248928-142248950 GAGGGAGCAGGCAGGGAGTGAGG + Intergenic
963430572 3:145196964-145196986 GAGGGAGAGTGTGGTGATTGTGG + Intergenic
963528852 3:146447986-146448008 GAGGGAGAACACAGTGATTGTGG - Intronic
963676129 3:148314588-148314610 AAGGGAGAGTGCAGTAATTGTGG + Intergenic
964253587 3:154749445-154749467 GAAGGAGAATGCAATGATTATGG + Intergenic
964259038 3:154812392-154812414 GAGGGAGAGCACAGTGATTGTGG - Intergenic
964583009 3:158260867-158260889 GAGGGAAAGTACAGTGATTGTGG - Intronic
964686663 3:159403486-159403508 AAGAGAGAGTGCAGTGATTGAGG + Intronic
964784192 3:160376187-160376209 GATGGAGACTGCAGTGACAAAGG - Intronic
965020204 3:163218852-163218874 GAGGGAGATTGCAGTTATTGTGG - Intergenic
965145108 3:164890815-164890837 GAGGGAGAGGGTAGTGATTGTGG - Intergenic
965264051 3:166518183-166518205 GAGGGAAAGTGCAGTTACTGTGG + Intergenic
965535363 3:169818170-169818192 GAGGGAGAGGAAAGTGACTGTGG - Intergenic
965844394 3:172945579-172945601 GAGGGAGAATACAGTAATTGTGG + Intronic
966454108 3:180095060-180095082 GAGGGAGAACACGGTGATTGTGG - Intergenic
967697062 3:192544178-192544200 GAGGGAGAGCACAGTGATTGTGG - Intronic
967928847 3:194675332-194675354 GCGTGAGAAAGCAGTGACAGGGG - Intergenic
968936304 4:3612252-3612274 GCAGGAGGAGGCAGTGACTGTGG + Intergenic
969048185 4:4353608-4353630 GGGAGAGAATCCAGTGGCTGTGG + Intronic
969258156 4:6016958-6016980 GAAGCACAATGCAGTGACAGCGG - Intergenic
969626816 4:8309785-8309807 GAGGGAGCAGGCAGGGACTCTGG - Intergenic
970226347 4:13861525-13861547 GAGGGAGAATTCAAGGACAGTGG - Intergenic
970275747 4:14398638-14398660 GAGAGAGCATGTAGTTACTGTGG - Intergenic
970479988 4:16463164-16463186 GAGGGACAAAGCAGAGAGTGTGG - Intergenic
970962160 4:21884828-21884850 AAGAGGGAAGGCAGTGACTGTGG - Intronic
970963232 4:21897958-21897980 GAGGGAAAGTGCAGTGATTATGG + Intronic
971478965 4:27097609-27097631 GAAGGTGAAGGCAGGGACTGGGG + Intergenic
971747554 4:30603307-30603329 GAGGGAGATTGCAGTGAGCCAGG + Intergenic
971911766 4:32803711-32803733 GAGGGGGGATGCAGTGTCTTCGG - Intergenic
972125400 4:35758932-35758954 GAGGGAGATTGCAGTGATTGTGG - Intergenic
972253677 4:37331878-37331900 AAGGGAGAGTACAGTGATTGTGG + Intronic
972271201 4:37512036-37512058 GAGGGAGAGCACAGTGATTGTGG - Intronic
972278569 4:37582067-37582089 GAGGGAGAGTACAGTGATTTGGG - Intronic
973060525 4:45718569-45718591 GAGGGAAAGTGAAGTGATTGTGG + Intergenic
973287946 4:48440429-48440451 GAGGGAGAGCACAGTGACTGTGG - Intergenic
973348442 4:49082257-49082279 GAGGGAAAGTGCAGTGATTGTGG + Intergenic
973852660 4:54976758-54976780 GAGGGAAAATGCAGCAACTTGGG + Intergenic
973919939 4:55674327-55674349 GAAGGAGAGTACAGTGATTGTGG - Intergenic
974047037 4:56907356-56907378 GAGGGGGAATGCAGTCAGTTTGG - Intergenic
974070604 4:57119822-57119844 AATGGAGAATGCACTGAGTGAGG - Intergenic
974266904 4:59597703-59597725 GAAGGATAGTGCAGGGACTGTGG + Intergenic
975095754 4:70454454-70454476 GAGGGAGCATGCAGTGCCTGTGG - Intronic
975295138 4:72726122-72726144 GAGGGAGAGCACAGTGATTGTGG + Intergenic
975533293 4:75422532-75422554 AAGGGAGAATTCACTGTCTGTGG - Intergenic
975950896 4:79769798-79769820 GGGGGAGAATTCAGTGGCTCTGG - Intergenic
976775136 4:88698815-88698837 GAGGAAGGAGGCAGTGAGTGGGG - Intronic
976775177 4:88698946-88698968 GAGGAAGAAGGCAGTGGGTGAGG - Intronic
977556772 4:98495011-98495033 CAGGGAGGAGTCAGTGACTGCGG + Intronic
977644388 4:99395644-99395666 GAGGGAGAGTGCAGTGATAGTGG + Intergenic
978387863 4:108193796-108193818 GAGTAAGAATGAAGTGACTGTGG + Intergenic
978654251 4:111048210-111048232 GAGGGAGAGCACAGTGATTGTGG + Intergenic
979213392 4:118133373-118133395 GAGGGAGAGCACAGTGACAGGGG - Intronic
979422239 4:120519275-120519297 GAGGGAAAATGCAATGTCTCGGG - Intergenic
979565190 4:122146463-122146485 GAAGGAGAGTGCAGTGATTGTGG - Intergenic
979929537 4:126613838-126613860 GAGGGAAAATGCTGTGAATTTGG - Intergenic
980172526 4:129306618-129306640 GAGGGAGAGCACAGTGACTGGGG - Intergenic
980752911 4:137115751-137115773 GAGGGAGAGCACAATGACTGTGG + Intergenic
980956506 4:139434026-139434048 GAGGGAGATCGCAGTGATTGTGG - Intergenic
981140121 4:141258676-141258698 GAGGGAGAACACAGTGATTGTGG + Intergenic
981394596 4:144233254-144233276 GAGGGACAGTGCATTGATTGAGG + Intergenic
981871198 4:149487738-149487760 GAAGGAGAGTGCAGTGACTAGGG - Intergenic
981996045 4:150976808-150976830 GTGGGAGAGTGCAGCGACTGTGG + Intronic
982308121 4:153954934-153954956 GAGCGAGAATTCAGTGATTCAGG + Intergenic
982683487 4:158459944-158459966 GAAGGAGAGTGCAGTGGCTGGGG - Intronic
983338183 4:166422025-166422047 GAGGGAGAGCACAGTGACTGTGG - Intergenic
983417626 4:167479368-167479390 GAGGGAGAGCAAAGTGACTGTGG + Intergenic
983657850 4:170101029-170101051 GAGGGAGAGTGCAGTGATTGTGG + Intergenic
984192396 4:176621403-176621425 AAGCTAGAATGCAGTGAGTGAGG + Intergenic
984441374 4:179774596-179774618 GAGAGAGAAAGCATTGCCTGAGG - Intergenic
984529877 4:180902738-180902760 GAGGGAGAGTGCAGTGACTGGGG - Intergenic
985030283 4:185782028-185782050 CAGGCAGAATGCAGTACCTGCGG - Intronic
985384858 4:189434625-189434647 GAGGGAGAGCACAGTAACTGGGG - Intergenic
986085204 5:4437946-4437968 AAGGGAGAGTGCAGTGATTGTGG - Intergenic
986495738 5:8340102-8340124 GAGGGAGGATGCAGACCCTGGGG + Intergenic
986548241 5:8923624-8923646 AAGGAAGAGTGCAGGGACTGTGG + Intergenic
986902982 5:12459935-12459957 GAGGTAGCATCTAGTGACTGAGG - Intergenic
987023577 5:13900085-13900107 CAGGATGAATGGAGTGACTGAGG - Intronic
987124856 5:14802691-14802713 GAGGGAGAATGGGATGGCTGAGG - Intronic
987215578 5:15733665-15733687 GAGGGTGAATGCAGTGGTAGCGG + Intronic
987616002 5:20275876-20275898 GAGGGAGAGTGCAGTGATTTGGG + Intronic
987645776 5:20671243-20671265 GAGGGAGAGTGAAGTGACTGTGG + Intergenic
987886183 5:23815903-23815925 GAGGGAGAGTAAAGTGAGTGTGG + Intergenic
987903778 5:24050027-24050049 GAGGGAGAGTGGGGTGATTGTGG + Intronic
988608645 5:32704160-32704182 GAGACAGAGTGCAATGACTGTGG - Intronic
989465979 5:41756398-41756420 GAGGCAGAATGCATGGACTCTGG + Intronic
990136628 5:52652904-52652926 GAGGGAGAATGCAATGTCATGGG - Intergenic
990799038 5:59578771-59578793 GAGGGAGAATGCAGATAATGTGG - Intronic
990799334 5:59582786-59582808 GAGGCAAAATGAGGTGACTGTGG - Intronic
990827816 5:59922043-59922065 GAGGGAGAGTGCAGCGACTGGGG + Intronic
991209250 5:64085213-64085235 GAGGGAGAGTGCAGTGACTGTGG - Intergenic
992116156 5:73540390-73540412 GAGTGAGACTTCAGTGACAGAGG + Intergenic
992531914 5:77660117-77660139 GAGGGAAAGTGCAGTGATTGTGG - Intergenic
992901988 5:81305991-81306013 GAGGGAGGAAGCAATGACTAGGG - Intronic
992934417 5:81687190-81687212 GAGGGAGAGCACAGTGACTGTGG + Intronic
993060167 5:83029485-83029507 TGGGGAGAGTGCAGTGATTGTGG + Intergenic
993138252 5:83997827-83997849 GAGGGAGAATGAAGTGATTGTGG + Intronic
993230274 5:85226569-85226591 AAGGGAGAGTGAAGTGAATGTGG - Intergenic
993256984 5:85604470-85604492 GAGGGAGGGAGCAGTGACGGTGG + Intergenic
993279263 5:85904749-85904771 GAGGGAAAGTGCAGTGACTGAGG + Intergenic
993932316 5:93954958-93954980 GAGGGAGAGCACAGTGACTGTGG - Intronic
993981134 5:94545037-94545059 GAGGGAGAGCACAGTGACTGGGG + Intronic
994046616 5:95317508-95317530 GAATGTTAATGCAGTGACTGTGG + Intergenic
994217975 5:97159918-97159940 GATGAAGAGTGCAGTGACTGTGG - Intronic
994320335 5:98387315-98387337 GAGGGGAAGTGCAGTGATTGTGG - Intergenic
994343678 5:98661422-98661444 GAGGGAGAACACAGCAACTGGGG + Intergenic
994533643 5:100999666-100999688 AAGGGAGAGTGAAGTGAGTGTGG + Intergenic
995265184 5:110151838-110151860 GAGGCAGAGCACAGTGACTGGGG + Intergenic
995268743 5:110195730-110195752 GAGGAAGAGTGCAGTGATTGTGG - Intergenic
995290373 5:110444375-110444397 GAGGGAGAGCTCAGTGACTGGGG - Intronic
995573287 5:113503637-113503659 AAGGGAGAGTGCAGTGATAGTGG - Intergenic
996166513 5:120229827-120229849 GAGGGAGAGTGCAGTGACTGGGG - Intergenic
996459423 5:123724727-123724749 GAGGGAGAGTGCAGCGACCGGGG + Intergenic
997437823 5:133887702-133887724 CAGGGACAGTCCAGTGACTGTGG + Intergenic
997749669 5:136331966-136331988 GAGGGTTTATGCAGTGGCTGGGG + Intronic
998225258 5:140321950-140321972 GAGGGAGGATGATGTGAATGAGG - Intergenic
998884055 5:146675810-146675832 GAGAGAGAGAGAAGTGACTGAGG - Intronic
999132549 5:149295596-149295618 GAGGGAGAATGGAGAGAAAGAGG + Intronic
999559447 5:152785116-152785138 GAGGGAGAGTGCACTGACTGTGG + Intergenic
1000539413 5:162521196-162521218 GAGGGAGAATGCAGTGATTGTGG - Intergenic
1001845254 5:174916444-174916466 GAGGGAGAATGCAGCAACTGTGG + Intergenic
1001900435 5:175422419-175422441 GAGGGAGAATCCACAGGCTGTGG + Intergenic
1001955125 5:175843675-175843697 GAGGGAGCAGGCAGGGCCTGGGG + Intronic
1003167723 6:3695913-3695935 GTGGGAGGATGCAGTGGCTGTGG + Intergenic
1003292850 6:4794597-4794619 GAGAGAGAGTGCAGGGACAGTGG + Intronic
1003491726 6:6628224-6628246 GAAGGAGAAAGGACTGACTGTGG - Intronic
1003702824 6:8489158-8489180 GGCGGAGATTGCAGTGATTGGGG + Intergenic
1003957133 6:11174421-11174443 GAGGGGGAGTGCAGTAAGTGTGG + Intergenic
1004913419 6:20308410-20308432 GAGGGAGAATGGAGGCAATGAGG - Intergenic
1004952938 6:20694673-20694695 GAGGGGGAAAGCAGTGACAAAGG - Intronic
1005311620 6:24564454-24564476 GAGGGAGGCTGCAGGGAATGAGG + Intronic
1006165422 6:32061788-32061810 GAGGGAGAAGGCTATGACTAGGG + Intronic
1006369494 6:33635036-33635058 GAGAAAGAAAGCATTGACTGGGG - Intronic
1006409766 6:33866150-33866172 GAGGAAGAATGAAGGGAGTGAGG - Intergenic
1006438278 6:34038158-34038180 GATGGAAAGAGCAGTGACTGAGG + Intronic
1007021742 6:38528116-38528138 GAGGCAGAGTGTAGTGACTGTGG + Intronic
1007370113 6:41421252-41421274 GAGGGATAAAGCAGAGCCTGAGG + Intergenic
1007642514 6:43353883-43353905 TGGGAAGAAAGCAGTGACTGGGG - Intronic
1007749663 6:44064215-44064237 CAGGGAGAACCCAGTGCCTGTGG - Intergenic
1008101148 6:47392496-47392518 GAGGGAGACAACAGTGACTGTGG - Intergenic
1008192266 6:48474837-48474859 GAGGAAGAATGCAGTAACTGTGG + Intergenic
1008848684 6:55997715-55997737 GAGGGAGAGTGCAGTGTTTGTGG - Intergenic
1009039464 6:58159103-58159125 GAGGCAGAATGCAGTGATTATGG - Intergenic
1009189712 6:60615507-60615529 GAGGGAGGATGAAGGGAGTGGGG + Intergenic
1009215356 6:60913943-60913965 GAGGCAGAATGCAGTGATTATGG - Intergenic
1009748207 6:67847707-67847729 GAGGGAGAGCGCAGTGACTGGGG + Intergenic
1009781673 6:68279681-68279703 GAGGGAGAGTGCAGTGATTGTGG + Intergenic
1009823749 6:68839900-68839922 GAGGGAGAGCACAGTGATTGTGG + Intronic
1009978787 6:70701665-70701687 AAGGGAGAACGCAGTGATTGTGG - Intronic
1010062273 6:71636479-71636501 GAGGGAGAGCACAGTGATTGTGG - Intergenic
1010109047 6:72203054-72203076 GACGGAGCATGCAGTGAGTCGGG - Intronic
1010317435 6:74467229-74467251 GGGGGAGGATGCAGACACTGAGG - Intergenic
1010444678 6:75936796-75936818 GAGGGAGAATTCTGACACTGGGG + Intronic
1010771875 6:79841199-79841221 CAGGCAGAATGCAGTGAGGGGGG - Intergenic
1011773543 6:90702347-90702369 GAGGGAGGATGCAGATAATGGGG + Intergenic
1012824238 6:104126822-104126844 GAGGGAGATTGCAGTGATTGTGG - Intergenic
1012827232 6:104162172-104162194 GAGGGAGAACGCAGTGACCATGG + Intergenic
1013280345 6:108630405-108630427 GAGTGAGGAGGCAGTGCCTGAGG + Intronic
1013932755 6:115554377-115554399 GAGGGTGACTGGAATGACTGAGG - Intergenic
1014275610 6:119384877-119384899 GAGGAAGAGTGCAGCGACTGCGG - Intergenic
1014794605 6:125710323-125710345 GAGGGAGAACGCAGGAATTGTGG + Intergenic
1015426136 6:133070041-133070063 GATGGAGAATGAAGAGAGTGAGG + Intergenic
1015578935 6:134702471-134702493 GAGAGAGAGTGCAGTGACTGTGG - Intergenic
1015978769 6:138818173-138818195 GAGGGGGAATGCATTGACCCAGG + Intronic
1016457464 6:144245763-144245785 GAGGGAGAGCACAGTGATTGTGG - Intergenic
1017116769 6:150985067-150985089 GATGGAGAAGGCATGGACTGTGG + Intronic
1017751246 6:157492209-157492231 CAGGGAGACTACAGTGGCTGGGG - Intronic
1017869968 6:158478967-158478989 GGCTGAAAATGCAGTGACTGTGG + Intronic
1018466891 6:164056077-164056099 GAGGGAGAGGGCAGTGAGTGTGG + Intergenic
1018711037 6:166498398-166498420 GCGGAAGAAGGCAGTGCCTGAGG - Intronic
1018724689 6:166602744-166602766 GAGGGAGAAGGATGAGACTGGGG + Intronic
1018768407 6:166952087-166952109 GAAGGAGAAGGCAGAGATTGGGG + Intronic
1019361250 7:605209-605231 GAGGGAGGATGATGTCACTGAGG + Intronic
1019803777 7:3107604-3107626 GAATGAGAACCCAGTGACTGGGG + Intergenic
1020485506 7:8715231-8715253 GAGGGAGAGTGTAGTGATTGTGG - Intronic
1020574936 7:9913998-9914020 AAGGGAGAGTGTAGTGATTGTGG - Intergenic
1020760164 7:12259153-12259175 GAGGTAGTATGAAGTGAGTGTGG - Intergenic
1021123628 7:16825634-16825656 GAGGGAGAATGCAGTGATTATGG + Intronic
1021650243 7:22825977-22825999 TAGTAAGAATGCAGTGAATGTGG + Intergenic
1022032229 7:26503016-26503038 CAGGGAGAATGAAATAACTGTGG + Intergenic
1022034252 7:26518881-26518903 GAGGGAGGGTACAGTGATTGTGG + Intergenic
1022770667 7:33469155-33469177 GAGGGAGAATAAAGAGACTGAGG + Intronic
1023248568 7:38233211-38233233 GAGAGAGAATGCAGTGGTGGTGG - Intergenic
1023646162 7:42318270-42318292 GAGGGAGAGTGCAGTGGTTGTGG + Intergenic
1023877388 7:44294377-44294399 GAGGGAGCAATCAGTGCCTGGGG - Intronic
1024243987 7:47455688-47455710 GAGAGAGAAGGCAGTGCCAGAGG + Intronic
1024369223 7:48560324-48560346 GAGGAAGAGCACAGTGACTGGGG - Intronic
1024705957 7:51959786-51959808 GAGGAAGAATGCAGTGACTGGGG - Intergenic
1024872361 7:53980252-53980274 GAGGGAGGAAGCAGTGAGAGAGG + Intergenic
1025061535 7:55812847-55812869 GAGGGAGAGTGAAGTGATTGTGG + Intronic
1026023001 7:66725352-66725374 GGGGCAGAATGGAGGGACTGTGG - Intronic
1026237236 7:68537991-68538013 GAAGGAGAACCCAGTGAATGGGG - Intergenic
1027523954 7:79244450-79244472 GAGGGAGAGTGCAGTGATTGTGG + Intronic
1027910886 7:84248897-84248919 GAGGGAAGATGCAGTCTCTGAGG - Intronic
1028299658 7:89181497-89181519 AAGGGAGACTGCAGGGACCGTGG - Intronic
1028868179 7:95737093-95737115 GAAGGAGAACCCAGTGACTGTGG - Intergenic
1028929665 7:96398415-96398437 GAGGGAGAATGCAGTGATTGTGG - Intergenic
1028972467 7:96874791-96874813 GAGAGAGAGTGCAGTGATTGTGG + Intergenic
1029042611 7:97593396-97593418 GAGGGAGAGTGCAGTGGCTGTGG - Intergenic
1029176154 7:98665981-98666003 GAGGGAAAATGAAGGAACTGGGG - Intergenic
1030629331 7:111878660-111878682 GTAGGATAATGCAGTGACTTGGG + Intronic
1030662619 7:112238246-112238268 GAGGGAGAGCGCAGTAATTGTGG + Intronic
1030966189 7:115995775-115995797 GAGAAAGAGTGCAGCGACTGTGG + Intronic
1030990226 7:116290848-116290870 GTGGGACAGTGCAGTGACTGTGG + Intronic
1031243858 7:119281648-119281670 GAGGGAGAGCACAGTGACTGGGG - Intergenic
1031272163 7:119665714-119665736 GAGGGAAGGTGCAGTGATTGTGG + Intergenic
1031355928 7:120786147-120786169 AAGGGAATATGCAGTGAGTGGGG - Intergenic
1031412600 7:121457441-121457463 GAGGGAGAATGCTGTGACTGTGG - Intergenic
1031535372 7:122927486-122927508 GAGGGACAAGGCTGGGACTGGGG - Intergenic
1031753664 7:125611458-125611480 GAGAGAGAGTGCAGTGATTATGG + Intergenic
1031862197 7:126993673-126993695 GAGGGAGAGCACAGTGACTGGGG + Intronic
1032003765 7:128283902-128283924 GAGGGCGACTGCTGTGACTACGG - Intergenic
1032079223 7:128850348-128850370 GAGGGAACAGTCAGTGACTGGGG - Intronic
1032590944 7:133191829-133191851 GTGGGAGAATGCTGGGGCTGGGG + Intergenic
1033258985 7:139826072-139826094 CAGGGAGCGAGCAGTGACTGTGG - Intronic
1033502515 7:141966089-141966111 GAAGGAGAGTGCAGTGATTGAGG - Intronic
1033542475 7:142369606-142369628 TAGGGAGAGTGCAGTGACTGTGG - Intergenic
1033577402 7:142699020-142699042 AAGGCAGAATGGAGTGAGTGTGG + Intergenic
1033857933 7:145588019-145588041 CATGGAGAATGCAGTGAGTTGGG - Intergenic
1033877774 7:145843226-145843248 GAGGGAGAGTGCAGTGATTGTGG - Intergenic
1034126285 7:148674825-148674847 GAGGGAGAGCACAGTGATTGTGG + Intergenic
1034322273 7:150197280-150197302 GAGGGACAATGGAGTCCCTGGGG - Intergenic
1034847915 7:154464262-154464284 CAGGGAGAATGCAGTGACTGTGG - Intronic
1034883690 7:154781374-154781396 GAGGGAGAACGAAGTGAGAGGGG - Intronic
1035074966 7:156171127-156171149 GAGGGAGCATGCTGGGACTCGGG - Intergenic
1035173315 7:157032982-157033004 AAGGGTGAAAGCAGTGACCGGGG - Intergenic
1035367936 7:158360903-158360925 GAGGGTGGATGCAGGGTCTGTGG - Intronic
1035368002 7:158361148-158361170 GAGGGTGGATGCAGGGTCTGTGG - Intronic
1035368030 7:158361242-158361264 GAGGGTGGATGCAGGGTCTGTGG - Intronic
1035545552 8:479636-479658 GAGGGAAAATGTAGTAATTGGGG - Intergenic
1035671163 8:1418138-1418160 GAAGGAGAATGCTGTGCATGAGG - Intergenic
1035745389 8:1958951-1958973 GGTTGAGACTGCAGTGACTGTGG - Intergenic
1037254739 8:16941133-16941155 GAGGGAGAGCACAGTGACTAGGG + Intergenic
1037277870 8:17200844-17200866 GAAGGTGAATGAACTGACTGCGG + Intronic
1038551550 8:28473484-28473506 GAGGGAGAATGAATTATCTGGGG - Intronic
1039035217 8:33352148-33352170 GACACAGAAAGCAGTGACTGTGG - Intergenic
1039392084 8:37189462-37189484 GAGAGAGAATGGAGAGAGTGTGG + Intergenic
1039796409 8:40919270-40919292 GAGGGAGAAGGTAGTGTCAGGGG - Intergenic
1040960409 8:53026040-53026062 GAGTGAAAATGCAGACACTGTGG + Intergenic
1041184484 8:55284959-55284981 GCGAGAGATTGCAGTGACTTAGG - Intronic
1041900692 8:62978921-62978943 GAGGGACCATGCCGTGAGTGGGG - Exonic
1043063590 8:75537781-75537803 GAGTAAGAATGCACTGATTGGGG - Intronic
1043079971 8:75754837-75754859 GAGGGAGAGTGCAGTGACTATGG + Intergenic
1043499592 8:80839086-80839108 AAGGTAAAATGCAGTGAGTGGGG - Intronic
1043600225 8:81928617-81928639 GAGGGAGAGTGCAGCAACTGGGG + Intergenic
1044235425 8:89824712-89824734 GTGGGAGAATGCAGCATCTGTGG - Intergenic
1044241342 8:89892458-89892480 GAGGAAGAGTGCAGTGATTGTGG + Intergenic
1044257717 8:90084755-90084777 GAGTGAGAATGCAGTGACTAAGG + Intronic
1044497328 8:92902384-92902406 GAGGGAGAGTGCAGTGATTGTGG - Intronic
1044810945 8:96061313-96061335 GGGTGAGAATGAAGTGGCTGAGG - Intergenic
1044996024 8:97838959-97838981 TCGGGAGAATGCAGGGACTGGGG - Intronic
1045621116 8:103979777-103979799 GAGGAAGAGCGCAGTGACTGGGG + Intronic
1045821438 8:106343066-106343088 GAGTGAGAATGGAGTGATGGAGG - Intronic
1046384199 8:113487326-113487348 GAGGAAGAGCGCAGTGAGTGGGG - Intergenic
1046811543 8:118538559-118538581 GAGGGAGAGCACAGTGATTGTGG - Intronic
1048118672 8:131554818-131554840 GAGGGAGAGCACAGTGACTGTGG + Intergenic
1048732996 8:137464519-137464541 GAGGGAGAAAGAAGTGACTCTGG + Intergenic
1050238933 9:3613635-3613657 GAGGGAAAGTGCAGGGATTGTGG - Intergenic
1050248061 9:3713004-3713026 GTGGAAGAGTGCAGTGACTGGGG + Intergenic
1050644411 9:7703296-7703318 GAGGGAGAATACAGTCACTGAGG - Intergenic
1050907013 9:11016894-11016916 GAGGGAGAGCACAGTGATTGTGG - Intergenic
1051039220 9:12785666-12785688 GAGGGAGAATACAGTGATTATGG - Intronic
1051345608 9:16148093-16148115 GAGGGAGAGTGCAGTGGGTGGGG + Intergenic
1051405518 9:16733917-16733939 GTGGGAGAGTGCAGGGACTTAGG - Intronic
1051729614 9:20126822-20126844 GGGGGAGAATGTAGTGCCAGAGG + Intergenic
1052093880 9:24361732-24361754 GAGGGAGAGCACAGTGATTGTGG + Intergenic
1052450603 9:28625285-28625307 GAGGGAGAACACAGTGACTTAGG - Intronic
1052979786 9:34439740-34439762 GATGCTGAATGTAGTGACTGGGG + Intronic
1053606675 9:39666974-39666996 GAGAGAGAATGAAATGAATGAGG + Intergenic
1054246860 9:62675430-62675452 GAGAGAGAATGAAATGAATGAGG - Intergenic
1054560981 9:66709964-66709986 GAGAGAGAATGAAATGAATGAGG - Intergenic
1054818267 9:69496522-69496544 GAGAGAGAGGGCAGTGCCTGAGG - Intronic
1055283555 9:74702811-74702833 GAAGGAGAGTGAAGTGAGTGTGG + Intergenic
1055355763 9:75435602-75435624 GAAAGGGACTGCAGTGACTGAGG - Intergenic
1055994292 9:82140894-82140916 GAGGGAGAATGCTGTGAACCCGG - Intergenic
1056230694 9:84539729-84539751 GAGGGAGAACACAGTGATTGTGG - Intergenic
1056338702 9:85602852-85602874 GAGAGAACATGCAGTGACTGTGG + Intronic
1056516664 9:87358798-87358820 GAGAGAAAGTGCAGTGACTGTGG + Intergenic
1057023962 9:91722061-91722083 GAGAGAGTATGCAGAGACTCAGG - Intronic
1057241227 9:93411777-93411799 GAGAGAAAGTGCAGTGATTGTGG - Intergenic
1058285364 9:103170066-103170088 GAGGGAGAGGGCAGTGACTGTGG - Intergenic
1058379070 9:104358866-104358888 GAGGGAGAATCCAGAGTCTAAGG + Intergenic
1058499960 9:105603292-105603314 GAAGTAGAAAGCACTGACTGAGG - Intronic
1058836093 9:108859648-108859670 ATGGAAGAATGCAGAGACTGTGG - Intergenic
1059147617 9:111915085-111915107 GAGGGAGAAAGCAGTGTTAGTGG + Intronic
1059555601 9:115277132-115277154 AAGGGAGAGTGCAGTGATTGTGG - Intronic
1059642093 9:116227391-116227413 GAGGGAAAATGCACCGACTTAGG - Intronic
1059887408 9:118761672-118761694 GAGGGAGAAAGCAGCGGCAGTGG + Intergenic
1059897597 9:118884486-118884508 TAGAGAGACTGAAGTGACTGTGG + Intergenic
1060342908 9:122792711-122792733 CAGGCAGAATGCAGTGCCTTAGG - Intergenic
1060756097 9:126215039-126215061 GAGAGAGAAACCAGGGACTGGGG - Intergenic
1061307753 9:129741933-129741955 GAGGGAGAAACCAAAGACTGGGG + Intronic
1061371147 9:130198260-130198282 GAGGAAGGACGCAGAGACTGAGG + Intronic
1061427975 9:130512684-130512706 GAGGGACAAAGAAGTGAATGAGG - Intergenic
1061638141 9:131928556-131928578 GAGGGAGAGCACAGCGACTGGGG + Intronic
1061916043 9:133754778-133754800 GAGGGAGACAGCTGTGACTTTGG + Intergenic
1061925641 9:133804897-133804919 GAGGGAGCAGGCAGTGCTTGTGG - Intronic
1062490820 9:136804087-136804109 GAGGGTGAGAGCAGTGTCTGGGG + Intronic
1062539355 9:137034784-137034806 GAGGGAGCAGGCTGTGGCTGCGG - Exonic
1186602035 X:11048607-11048629 GAGGGAGAGCACAGTGTCTGGGG - Intergenic
1187075692 X:15932228-15932250 AAGGGAGAATGCAGTACCTGAGG + Intergenic
1187636676 X:21237416-21237438 GAGGGAGAACATAGTGACTGTGG + Intergenic
1188649935 X:32619981-32620003 GAGGGTGAAAGCAGAGATTGTGG - Intronic
1188854545 X:35177129-35177151 CTGGGAGAAAGCAGTCACTGTGG + Intergenic
1188897345 X:35685820-35685842 AAGGGAGATAGCAGTGACTGGGG + Intergenic
1188945015 X:36290008-36290030 GAGGGAGAATGGGACGACTGGGG - Intronic
1189262410 X:39688167-39688189 GAGAGAGAAGACAGTGTCTGGGG - Intergenic
1189390301 X:40570771-40570793 AAGGGAGGAAGCAGTGAGTGGGG + Intergenic
1189405608 X:40720354-40720376 GAGGGAGAGAATAGTGACTGGGG + Intronic
1190122598 X:47674550-47674572 AAGGGAGAACACAGTGAATGTGG - Intergenic
1190374468 X:49775452-49775474 GAGGGAGAGTGCAGCAACTGGGG - Intergenic
1190604436 X:52126410-52126432 GAGGGAGGATGCAGACCCTGGGG + Intergenic
1191197060 X:57736026-57736048 GTGGGAGAGTTTAGTGACTGGGG + Intergenic
1191974226 X:66852227-66852249 GAGGGAGAGTGCAGAGACTAGGG - Intergenic
1191990958 X:67036598-67036620 GAGGGAGAGCACAATGACTGGGG - Intergenic
1192046108 X:67675598-67675620 GAGGAAGATTGCAGTGACTGTGG - Intronic
1192134943 X:68588514-68588536 GAGGAAGAACACAGTGACTAGGG + Intergenic
1192793301 X:74405734-74405756 AAGGGAGAGTGCAGTGATTGTGG + Intergenic
1192839304 X:74837103-74837125 GAGGGAGAGTGAAGTGACTGGGG - Intronic
1192875349 X:75223646-75223668 GAGGGAAACTGCAGTGATTGTGG - Intergenic
1192890814 X:75389051-75389073 GAGGGAGAGTGCAGTGACTGTGG + Intronic
1193052536 X:77116266-77116288 GAGGGAGAGTGCAGCAATTGTGG - Intergenic
1193246918 X:79239789-79239811 GAGGGAGAGTGCAGCAACTAGGG - Intergenic
1193440951 X:81538646-81538668 GAGAGAAAATGAAGTGATTGTGG + Intergenic
1193675980 X:84453415-84453437 GAAGGAGAGTACAGTGATTGTGG + Intronic
1193896934 X:87126495-87126517 GAGGGAGAGTGCAGTGATTATGG + Intergenic
1194251819 X:91585353-91585375 GAGGGAGAGTGCAGAAATTGTGG + Intergenic
1194329119 X:92559647-92559669 GAGGAATATTGCAGTGACTGGGG + Intronic
1194388929 X:93292458-93292480 GAGGGAGAATGCAGTGACTGGGG + Intergenic
1194526368 X:94982842-94982864 GTGGGAAAGTGCAGTGACTGTGG + Intergenic
1194842078 X:98754822-98754844 GAGGGAGAGCACAGTGACTGGGG - Intergenic
1195165208 X:102213233-102213255 GAAGAAGAAGGCAGTGACTGGGG - Intergenic
1195193650 X:102473858-102473880 GAAGAAGAAGGCAGTGACTGGGG + Intergenic
1195290156 X:103424429-103424451 GAGGGAGAGCACAGTGATTGTGG - Intergenic
1195477440 X:105303043-105303065 GGAGGAGAGTGCAGTGATTGTGG - Intronic
1195489470 X:105450216-105450238 GAGGGCGAGTGCAGTGACTTGGG - Intronic
1195595330 X:106682704-106682726 GAGGGAGAGTGCAGTGATTGTGG + Intergenic
1195771348 X:108354667-108354689 GAGTGAGAAAGGAGTGACTATGG - Intronic
1196215745 X:113050048-113050070 GAGGGAGAATGCAGCAATTGTGG + Intergenic
1196217703 X:113072669-113072691 GAGGGAGAGCTCAGTGATTGTGG - Intergenic
1196224162 X:113146028-113146050 GAGGAAGAATGGGGTGACTGGGG - Intergenic
1196357471 X:114810560-114810582 GAGGGAGAATGCAGTGACTGTGG - Intronic
1196384962 X:115139689-115139711 GAGGGAGAGCACAGGGACTGGGG + Intronic
1196485705 X:116204164-116204186 GAGGGAGAGTGCAGCAACTGGGG - Intergenic
1197030596 X:121809193-121809215 GAGGGACAGTGAAGTGAATGTGG - Intergenic
1197031722 X:121824174-121824196 TAGGAAGGATGCAGTGATTGTGG - Intergenic
1197099677 X:122637408-122637430 GAGGGAGAGCGCAGTGACTGTGG - Intergenic
1197457902 X:126700978-126701000 AAGGGAGAGCACAGTGACTGGGG + Intergenic
1197623651 X:128779836-128779858 GAGGGAGAGCACAGTGACTGGGG - Intergenic
1197953033 X:131918399-131918421 AAGGGAGAGTGCAGCAACTGTGG + Intergenic
1198134811 X:133738314-133738336 AAGGGAGAAAGCAATGACAGTGG - Intronic
1198180750 X:134206190-134206212 GAGGGAGAAGGGATTGATTGAGG + Intergenic
1198278063 X:135116201-135116223 GAGGGAGAGTGCAGCAAGTGGGG - Intergenic
1198292899 X:135256315-135256337 GAGGGAGAGTGCAGCAAGTGGGG + Intronic
1198452686 X:136783536-136783558 GAGGGGGAATTCAAAGACTGGGG + Intergenic
1198513970 X:137385537-137385559 GAGGGAGAATAAAGAGAATGAGG + Intergenic
1198761560 X:140038344-140038366 GAGGGAGAGGAAAGTGACTGTGG + Intergenic
1198770684 X:140126904-140126926 GAGGGAGAGTGTAGTGACTAGGG - Intergenic
1199277518 X:145963919-145963941 GAGGGACAGCGTAGTGACTGAGG + Intergenic
1199325090 X:146489932-146489954 GAGGGAGAGTACAGTGACTGAGG + Intergenic
1199393176 X:147305731-147305753 GAAGGACAGTGCAGTGACTTGGG + Intergenic
1199431838 X:147770666-147770688 GAGAGAGAGTTCAGTGGCTGTGG + Intergenic
1199484973 X:148337733-148337755 GAGGGAGAGCACAGAGACTGGGG + Intergenic
1199962819 X:152791772-152791794 GAGAGAGAGGGCAGTGATTGTGG + Intergenic
1200076501 X:153553869-153553891 GAGGGAGAATGCAAGGCATGGGG + Intronic
1200570753 Y:4826584-4826606 GAGGGAGAGTGCAGAAATTGTGG + Intergenic
1200637821 Y:5678837-5678859 GAGGAATATTGCAGTGACTGGGG + Intronic