ID: 1194391870

View in Genome Browser
Species Human (GRCh38)
Location X:93329003-93329025
Sequence CTGGAGAGTCTGCCTGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194391870_1194391874 2 Left 1194391870 X:93329003-93329025 CCATTCTCAGGCAGACTCTCCAG No data
Right 1194391874 X:93329028-93329050 AAAAATAGCAAAATGGCTGCTGG No data
1194391870_1194391872 -5 Left 1194391870 X:93329003-93329025 CCATTCTCAGGCAGACTCTCCAG No data
Right 1194391872 X:93329021-93329043 TCCAGGTAAAAATAGCAAAATGG No data
1194391870_1194391875 12 Left 1194391870 X:93329003-93329025 CCATTCTCAGGCAGACTCTCCAG No data
Right 1194391875 X:93329038-93329060 AAATGGCTGCTGGAAGATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194391870 Original CRISPR CTGGAGAGTCTGCCTGAGAA TGG (reversed) Intergenic
No off target data available for this crispr