ID: 1194397008

View in Genome Browser
Species Human (GRCh38)
Location X:93398790-93398812
Sequence TGGTAAATACAGAAAGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194397003_1194397008 25 Left 1194397003 X:93398742-93398764 CCTTACATTAGCATGGTGTACTT No data
Right 1194397008 X:93398790-93398812 TGGTAAATACAGAAAGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194397008 Original CRISPR TGGTAAATACAGAAAGAACC AGG Intergenic
No off target data available for this crispr