ID: 1194400555

View in Genome Browser
Species Human (GRCh38)
Location X:93434469-93434491
Sequence AAGGGTCTATTGAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194400549_1194400555 8 Left 1194400549 X:93434438-93434460 CCTTCAAGTGCATGGAGCATTAT 0: 7
1: 28
2: 40
3: 30
4: 112
Right 1194400555 X:93434469-93434491 AAGGGTCTATTGAACTCTGGGGG No data
1194400548_1194400555 9 Left 1194400548 X:93434437-93434459 CCCTTCAAGTGCATGGAGCATTA 0: 5
1: 31
2: 40
3: 34
4: 102
Right 1194400555 X:93434469-93434491 AAGGGTCTATTGAACTCTGGGGG No data
1194400546_1194400555 18 Left 1194400546 X:93434428-93434450 CCTTTTTAACCCTTCAAGTGCAT 0: 13
1: 14
2: 29
3: 34
4: 188
Right 1194400555 X:93434469-93434491 AAGGGTCTATTGAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194400555 Original CRISPR AAGGGTCTATTGAACTCTGG GGG Intergenic
No off target data available for this crispr