ID: 1194400618

View in Genome Browser
Species Human (GRCh38)
Location X:93434926-93434948
Sequence ACACCGCTGGGTCACCGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194400618_1194400625 27 Left 1194400618 X:93434926-93434948 CCAAAACGGTGACCCAGCGGTGT No data
Right 1194400625 X:93434976-93434998 CAAGGTCTAGCTGTTCCACCTGG No data
1194400618_1194400622 4 Left 1194400618 X:93434926-93434948 CCAAAACGGTGACCCAGCGGTGT No data
Right 1194400622 X:93434953-93434975 CCTGCCGACAGCATAATGCGAGG No data
1194400618_1194400624 9 Left 1194400618 X:93434926-93434948 CCAAAACGGTGACCCAGCGGTGT No data
Right 1194400624 X:93434958-93434980 CGACAGCATAATGCGAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194400618 Original CRISPR ACACCGCTGGGTCACCGTTT TGG (reversed) Intergenic
No off target data available for this crispr