ID: 1194403611

View in Genome Browser
Species Human (GRCh38)
Location X:93467798-93467820
Sequence AGGCCCATGCGGCCCTTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194403611_1194403617 -1 Left 1194403611 X:93467798-93467820 CCCATGAAGGGCCGCATGGGCCT No data
Right 1194403617 X:93467820-93467842 TTGGATCCCTGAGAACCCCTGGG No data
1194403611_1194403627 30 Left 1194403611 X:93467798-93467820 CCCATGAAGGGCCGCATGGGCCT No data
Right 1194403627 X:93467851-93467873 CACAGCCCTGCCAACAAGGGAGG No data
1194403611_1194403625 27 Left 1194403611 X:93467798-93467820 CCCATGAAGGGCCGCATGGGCCT No data
Right 1194403625 X:93467848-93467870 TGCCACAGCCCTGCCAACAAGGG No data
1194403611_1194403624 26 Left 1194403611 X:93467798-93467820 CCCATGAAGGGCCGCATGGGCCT No data
Right 1194403624 X:93467847-93467869 CTGCCACAGCCCTGCCAACAAGG No data
1194403611_1194403616 -2 Left 1194403611 X:93467798-93467820 CCCATGAAGGGCCGCATGGGCCT No data
Right 1194403616 X:93467819-93467841 CTTGGATCCCTGAGAACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194403611 Original CRISPR AGGCCCATGCGGCCCTTCAT GGG (reversed) Intergenic
No off target data available for this crispr