ID: 1194403615

View in Genome Browser
Species Human (GRCh38)
Location X:93467818-93467840
Sequence CAGGGGTTCTCAGGGATCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194403615_1194403627 10 Left 1194403615 X:93467818-93467840 CCTTGGATCCCTGAGAACCCCTG No data
Right 1194403627 X:93467851-93467873 CACAGCCCTGCCAACAAGGGAGG No data
1194403615_1194403625 7 Left 1194403615 X:93467818-93467840 CCTTGGATCCCTGAGAACCCCTG No data
Right 1194403625 X:93467848-93467870 TGCCACAGCCCTGCCAACAAGGG No data
1194403615_1194403624 6 Left 1194403615 X:93467818-93467840 CCTTGGATCCCTGAGAACCCCTG No data
Right 1194403624 X:93467847-93467869 CTGCCACAGCCCTGCCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194403615 Original CRISPR CAGGGGTTCTCAGGGATCCA AGG (reversed) Intergenic
No off target data available for this crispr