ID: 1194403619

View in Genome Browser
Species Human (GRCh38)
Location X:93467827-93467849
Sequence CAGCTGGCCCAGGGGTTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194403619_1194403631 26 Left 1194403619 X:93467827-93467849 CCTGAGAACCCCTGGGCCAGCTG No data
Right 1194403631 X:93467876-93467898 AAGCTCTTTTGTGAATCTCTAGG No data
1194403619_1194403624 -3 Left 1194403619 X:93467827-93467849 CCTGAGAACCCCTGGGCCAGCTG No data
Right 1194403624 X:93467847-93467869 CTGCCACAGCCCTGCCAACAAGG No data
1194403619_1194403627 1 Left 1194403619 X:93467827-93467849 CCTGAGAACCCCTGGGCCAGCTG No data
Right 1194403627 X:93467851-93467873 CACAGCCCTGCCAACAAGGGAGG No data
1194403619_1194403625 -2 Left 1194403619 X:93467827-93467849 CCTGAGAACCCCTGGGCCAGCTG No data
Right 1194403625 X:93467848-93467870 TGCCACAGCCCTGCCAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194403619 Original CRISPR CAGCTGGCCCAGGGGTTCTC AGG (reversed) Intergenic
No off target data available for this crispr