ID: 1194403624

View in Genome Browser
Species Human (GRCh38)
Location X:93467847-93467869
Sequence CTGCCACAGCCCTGCCAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194403611_1194403624 26 Left 1194403611 X:93467798-93467820 CCCATGAAGGGCCGCATGGGCCT No data
Right 1194403624 X:93467847-93467869 CTGCCACAGCCCTGCCAACAAGG No data
1194403612_1194403624 25 Left 1194403612 X:93467799-93467821 CCATGAAGGGCCGCATGGGCCTT No data
Right 1194403624 X:93467847-93467869 CTGCCACAGCCCTGCCAACAAGG No data
1194403615_1194403624 6 Left 1194403615 X:93467818-93467840 CCTTGGATCCCTGAGAACCCCTG No data
Right 1194403624 X:93467847-93467869 CTGCCACAGCCCTGCCAACAAGG No data
1194403618_1194403624 -2 Left 1194403618 X:93467826-93467848 CCCTGAGAACCCCTGGGCCAGCT No data
Right 1194403624 X:93467847-93467869 CTGCCACAGCCCTGCCAACAAGG No data
1194403619_1194403624 -3 Left 1194403619 X:93467827-93467849 CCTGAGAACCCCTGGGCCAGCTG No data
Right 1194403624 X:93467847-93467869 CTGCCACAGCCCTGCCAACAAGG No data
1194403614_1194403624 15 Left 1194403614 X:93467809-93467831 CCGCATGGGCCTTGGATCCCTGA No data
Right 1194403624 X:93467847-93467869 CTGCCACAGCCCTGCCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194403624 Original CRISPR CTGCCACAGCCCTGCCAACA AGG Intergenic
No off target data available for this crispr