ID: 1194413388

View in Genome Browser
Species Human (GRCh38)
Location X:93581115-93581137
Sequence TCACCATGATGGGTTGCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194413388_1194413394 23 Left 1194413388 X:93581115-93581137 CCACAAGCAACCCATCATGGTGA No data
Right 1194413394 X:93581161-93581183 CAGAGTTACTTATGACCAAGAGG No data
1194413388_1194413392 -3 Left 1194413388 X:93581115-93581137 CCACAAGCAACCCATCATGGTGA No data
Right 1194413392 X:93581135-93581157 TGAGCTGAGAAATTAGCTGCGGG No data
1194413388_1194413393 -2 Left 1194413388 X:93581115-93581137 CCACAAGCAACCCATCATGGTGA No data
Right 1194413393 X:93581136-93581158 GAGCTGAGAAATTAGCTGCGGGG No data
1194413388_1194413391 -4 Left 1194413388 X:93581115-93581137 CCACAAGCAACCCATCATGGTGA No data
Right 1194413391 X:93581134-93581156 GTGAGCTGAGAAATTAGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194413388 Original CRISPR TCACCATGATGGGTTGCTTG TGG (reversed) Intergenic