ID: 1194414003

View in Genome Browser
Species Human (GRCh38)
Location X:93588352-93588374
Sequence CTGTAAAAGCAGGAAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194413996_1194414003 28 Left 1194413996 X:93588301-93588323 CCCAGAAGAGGACAAAACACAAG No data
Right 1194414003 X:93588352-93588374 CTGTAAAAGCAGGAAGAGAAAGG No data
1194413997_1194414003 27 Left 1194413997 X:93588302-93588324 CCAGAAGAGGACAAAACACAAGT No data
Right 1194414003 X:93588352-93588374 CTGTAAAAGCAGGAAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194414003 Original CRISPR CTGTAAAAGCAGGAAGAGAA AGG Intergenic
No off target data available for this crispr