ID: 1194418942

View in Genome Browser
Species Human (GRCh38)
Location X:93649007-93649029
Sequence TAATCATTCAACCAGTCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194418942_1194418946 3 Left 1194418942 X:93649007-93649029 CCTAGAGACTGGTTGAATGATTA No data
Right 1194418946 X:93649033-93649055 CCCAAATGGTGATGGTGATATGG No data
1194418942_1194418951 24 Left 1194418942 X:93649007-93649029 CCTAGAGACTGGTTGAATGATTA No data
Right 1194418951 X:93649054-93649076 GGGCAGTGAAGGCCAGGCTGAGG No data
1194418942_1194418944 -5 Left 1194418942 X:93649007-93649029 CCTAGAGACTGGTTGAATGATTA No data
Right 1194418944 X:93649025-93649047 GATTATGACCCAAATGGTGATGG No data
1194418942_1194418950 18 Left 1194418942 X:93649007-93649029 CCTAGAGACTGGTTGAATGATTA No data
Right 1194418950 X:93649048-93649070 TGATATGGGCAGTGAAGGCCAGG No data
1194418942_1194418949 13 Left 1194418942 X:93649007-93649029 CCTAGAGACTGGTTGAATGATTA No data
Right 1194418949 X:93649043-93649065 GATGGTGATATGGGCAGTGAAGG No data
1194418942_1194418952 27 Left 1194418942 X:93649007-93649029 CCTAGAGACTGGTTGAATGATTA No data
Right 1194418952 X:93649057-93649079 CAGTGAAGGCCAGGCTGAGGAGG 0: 34
1: 150
2: 813
3: 1714
4: 2633
1194418942_1194418948 4 Left 1194418942 X:93649007-93649029 CCTAGAGACTGGTTGAATGATTA No data
Right 1194418948 X:93649034-93649056 CCAAATGGTGATGGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194418942 Original CRISPR TAATCATTCAACCAGTCTCT AGG (reversed) Intergenic
No off target data available for this crispr