ID: 1194418948

View in Genome Browser
Species Human (GRCh38)
Location X:93649034-93649056
Sequence CCAAATGGTGATGGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194418942_1194418948 4 Left 1194418942 X:93649007-93649029 CCTAGAGACTGGTTGAATGATTA No data
Right 1194418948 X:93649034-93649056 CCAAATGGTGATGGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194418948 Original CRISPR CCAAATGGTGATGGTGATAT GGG Intergenic
No off target data available for this crispr