ID: 1194419376

View in Genome Browser
Species Human (GRCh38)
Location X:93654015-93654037
Sequence TGTCAAATACTGCAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194419376_1194419379 18 Left 1194419376 X:93654015-93654037 CCTTCCACTTGCAGTATTTGACA No data
Right 1194419379 X:93654056-93654078 TTTTTTTTTATTACTAGGACAGG No data
1194419376_1194419378 13 Left 1194419376 X:93654015-93654037 CCTTCCACTTGCAGTATTTGACA No data
Right 1194419378 X:93654051-93654073 TTAATTTTTTTTTTATTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194419376 Original CRISPR TGTCAAATACTGCAAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr