ID: 1194427710

View in Genome Browser
Species Human (GRCh38)
Location X:93760414-93760436
Sequence CAGTAGCAACAGAGGCAGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194427707_1194427710 20 Left 1194427707 X:93760371-93760393 CCAATCAATCATCTCTGGAGGAG No data
Right 1194427710 X:93760414-93760436 CAGTAGCAACAGAGGCAGAGCGG No data
1194427705_1194427710 24 Left 1194427705 X:93760367-93760389 CCGACCAATCAATCATCTCTGGA No data
Right 1194427710 X:93760414-93760436 CAGTAGCAACAGAGGCAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194427710 Original CRISPR CAGTAGCAACAGAGGCAGAG CGG Intergenic
No off target data available for this crispr