ID: 1194431396

View in Genome Browser
Species Human (GRCh38)
Location X:93811289-93811311
Sequence AAGGGGAAATAGAAGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194431396_1194431401 -1 Left 1194431396 X:93811289-93811311 CCTTTCTCCTTCTATTTCCCCTT No data
Right 1194431401 X:93811311-93811333 TTCTTCTCTTCCCCTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194431396 Original CRISPR AAGGGGAAATAGAAGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr