ID: 1194436432

View in Genome Browser
Species Human (GRCh38)
Location X:93873526-93873548
Sequence GCCCATCAGGCATTTCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1194436426_1194436432 -9 Left 1194436426 X:93873512-93873534 CCTAGTGACACCATGCCCATCAG No data
Right 1194436432 X:93873526-93873548 GCCCATCAGGCATTTCTTGGGGG No data
1194436420_1194436432 26 Left 1194436420 X:93873477-93873499 CCCCTAAGGTCCTGAAATGAGAA No data
Right 1194436432 X:93873526-93873548 GCCCATCAGGCATTTCTTGGGGG No data
1194436425_1194436432 16 Left 1194436425 X:93873487-93873509 CCTGAAATGAGAAGGGAACTTGA No data
Right 1194436432 X:93873526-93873548 GCCCATCAGGCATTTCTTGGGGG No data
1194436421_1194436432 25 Left 1194436421 X:93873478-93873500 CCCTAAGGTCCTGAAATGAGAAG No data
Right 1194436432 X:93873526-93873548 GCCCATCAGGCATTTCTTGGGGG No data
1194436419_1194436432 27 Left 1194436419 X:93873476-93873498 CCCCCTAAGGTCCTGAAATGAGA No data
Right 1194436432 X:93873526-93873548 GCCCATCAGGCATTTCTTGGGGG No data
1194436422_1194436432 24 Left 1194436422 X:93873479-93873501 CCTAAGGTCCTGAAATGAGAAGG No data
Right 1194436432 X:93873526-93873548 GCCCATCAGGCATTTCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1194436432 Original CRISPR GCCCATCAGGCATTTCTTGG GGG Intergenic
No off target data available for this crispr